Rorug02G0230000

GDP-fucose protein O-fucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
22795132 .. 22795562
431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0230000.1

Sequence Viewer

Length: 276 bp
ATGAATAACACAACTCAAGATCTTAGGATTGTCAAACGTTTTGGAGCTTCATGTAGGCCAAGGTGTGTTCCTCGTATTATTGAGGTTCATTGGCATTCCCCGCCATATGGTTGGATTAAAATAAATACAGATGAGACTTGGAAGAGTACATCCCATGAAGCTGGTTATGGTGGTGTTTTTAGAGATCACAACGGAAGTGTCATAGTTCTATTTGTACTCCTTACTCCCAAGGATGTTGGTCGAGTGGGAGAGTTATTAGCTAAATTTGCAGGGTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.25

Weight (kDa)

9.44

Isoelectric Point (pI)

25.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015813)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 101
AclI AACGTT 1 cut(s) 37
AcsI RAATTY 1 cut(s) 263
AfaI GTAC 2 cut(s) 148, 216
AfiI CCNNNNNNNGG 1 cut(s) 107
AluBI AGCT 3 cut(s) 47, 161, 260
AluI AGCT 3 cut(s) 47, 161, 260
Alw26I GTCTC 1 cut(s) 128
AoxI GGCC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 263
BcoDI GTCTC 1 cut(s) 128
BglII AGATCT 1 cut(s) 19
BsaJI CCNNGG 2 cut(s) 59, 228
Bsc4I CCNNNNNNNGG 1 cut(s) 107
BseDI CCNNGG 2 cut(s) 59, 228
BseGI GGATG 2 cut(s) 149, 238
BseLI CCNNNNNNNGG 1 cut(s) 107
BshFI GGCC 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 128
BsmI GAATGC 1 cut(s) 94
BsnI GGCC 1 cut(s) 58
Bsp143I GATC 2 cut(s) 19, 184
BspACI CCGC 1 cut(s) 101
BspANI GGCC 1 cut(s) 58
BssECI CCNNGG 2 cut(s) 59, 228
BssMI GATC 2 cut(s) 19, 184
BssT1I CCWWGG 2 cut(s) 59, 228
Bst6I CTCTTC 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 23
BstF5I GGATG 2 cut(s) 149, 238
BstKTI GATC 2 cut(s) 22, 187
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 2 cut(s) 19, 184
BstMWI GCNNNNNNNGC 2 cut(s) 100, 266
BstX2I RGATCY 1 cut(s) 19
BstXI CCANNNNNNTGG 2 cut(s) 111, 161
BstYI RGATCY 1 cut(s) 19
BsuRI GGCC 1 cut(s) 58
BtsCI GGATG 2 cut(s) 149, 238
Csp6I GTAC 2 cut(s) 147, 215
CviAII CATG 2 cut(s) 51, 155
CviJI RGCY 4 cut(s) 47, 58, 161, 260
CviKI_1 RGCY 4 cut(s) 47, 58, 161, 260
CviQI GTAC 2 cut(s) 147, 215
DdeI CTNAG 1 cut(s) 23
DpnI GATC 2 cut(s) 21, 186
DpnII GATC 2 cut(s) 19, 184
Eam1104I CTCTTC 1 cut(s) 137
EarI CTCTTC 1 cut(s) 137
Eco130I CCWWGG 2 cut(s) 59, 228
EcoT14I CCWWGG 2 cut(s) 59, 228
ErhI CCWWGG 2 cut(s) 59, 228
FaeI CATG 2 cut(s) 54, 158
FaiI YATR 6 cut(s) 52, 106, 108, 156, 168, 203
FatI CATG 2 cut(s) 50, 154
FauI CCCGC 1 cut(s) 108
FauNDI CATATG 1 cut(s) 106
FokI GGATG 2 cut(s) 136, 245
HaeIII GGCC 1 cut(s) 58
Hin1II CATG 2 cut(s) 54, 158
Hpy188III TCNNGA 1 cut(s) 17
HpyCH4IV ACGT 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 269
HpyF10VI GCNNNNNNNGC 2 cut(s) 100, 266
HpyF3I CTNAG 1 cut(s) 23
HpySE526I ACGT 1 cut(s) 37
Hsp92II CATG 2 cut(s) 54, 158
Kzo9I GATC 2 cut(s) 19, 184
LmnI GCTCC 1 cut(s) 44
LpnPI CCDG 2 cut(s) 147, 255
MaeII ACGT 1 cut(s) 37
MalI GATC 2 cut(s) 21, 186
MboI GATC 2 cut(s) 19, 184
MboII GAAGA 1 cut(s) 154
MflI RGATCY 1 cut(s) 19
MluCI AATT 1 cut(s) 263
MmeI TCCRAC 1 cut(s) 92
MnlI CCTC 2 cut(s) 76, 81
MseI TTAA 1 cut(s) 117
Mva1269I GAATGC 1 cut(s) 94
MwoI GCNNNNNNNGC 2 cut(s) 100, 266
NdeI CATATG 1 cut(s) 106
NdeII GATC 2 cut(s) 19, 184
NlaIII CATG 2 cut(s) 54, 158
PctI GAATGC 1 cut(s) 94
Psp1406I AACGTT 1 cut(s) 37
PsuI RGATCY 1 cut(s) 19
RsaI GTAC 2 cut(s) 148, 216
RsaNI GTAC 2 cut(s) 147, 215
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 2 cut(s) 19, 184
SetI ASST 6 cut(s) 40, 49, 65, 87, 163, 262
SmlI CTYRAG 1 cut(s) 15
SmoI CTYRAG 1 cut(s) 15
Sse9I AATT 1 cut(s) 263
SsiI CCGC 1 cut(s) 101
StyI CCWWGG 2 cut(s) 59, 228
TaiI ACGT 1 cut(s) 40
TaqI TCGA 1 cut(s) 241
TasI AATT 1 cut(s) 263
TatI WGTACW 2 cut(s) 146, 214
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 4 cut(s) 17, 39, 77, 171
TspGWI ACGGA 1 cut(s) 207
XapI RAATTY 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.