Rorug02G0240800

ultraviolet-B receptor

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
24748377 .. 24750562
2186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0240800.1

Sequence Viewer

Length: 225 bp
ATGAAAGCTATAAGTGATGATTGTGAAAGATTCATATCTTTTCCTCCTGGGCATCTATACTCTAGCAAACAAGGAGGGCTGAGAAGTTGGTACAATCCAGAATGGTTTTTGGAGAAGATACCATCATCTCCTTATGATCCCATTGTTTTATGCGAGGCTTTTGAGAAGGTATGCATTGATGTGTGCTACTTACAATCCTACTTCTTTTCTTTTTTGTTTTGTTAA

Protein Analysis

74

Amino Acids

8.69

Weight (kDa)

4.83

Isoelectric Point (pI)

51.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012331)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 131
AfaI GTAC 1 cut(s) 92
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
AlwI GGATC 1 cut(s) 131
BccI CCATC 1 cut(s) 130
BciT130I CCWGG 1 cut(s) 48
BfaI CTAG 1 cut(s) 63
Bme1390I CCNGG 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 48
BmsI GCATC 1 cut(s) 61
BsaBI GATNNNNATC 1 cut(s) 34
BsaJI CCNNGG 1 cut(s) 47
Bse8I GATNNNNATC 1 cut(s) 34
BseBI CCWGG 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 47
BseJI GATNNNNATC 1 cut(s) 34
BseMII CTCAG 1 cut(s) 71
Bsp143I GATC 1 cut(s) 136
BspCNI CTCAG 1 cut(s) 72
BspPI GGATC 1 cut(s) 131
BssECI CCNNGG 1 cut(s) 47
BssMI GATC 1 cut(s) 136
Bst2UI CCWGG 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 80
BstKTI GATC 1 cut(s) 139
BstMBI GATC 1 cut(s) 136
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
Csp6I GTAC 1 cut(s) 91
CviJI RGCY 3 cut(s) 8, 79, 158
CviKI_1 RGCY 3 cut(s) 8, 79, 158
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 1 cut(s) 80
DpnI GATC 1 cut(s) 138
DpnII GATC 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 46
EcoT22I ATGCAT 1 cut(s) 176
FaiI YATR 6 cut(s) 11, 35, 58, 135, 151, 172
FspBI CTAG 1 cut(s) 63
HinfI GANTC 1 cut(s) 30
Hpy188III TCNNGA 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 160
HpyCH4V TGCA 1 cut(s) 174
HpyF3I CTNAG 1 cut(s) 80
Kzo9I GATC 1 cut(s) 136
LpnPI CCDG 3 cut(s) 33, 60, 111
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 63
MalI GATC 1 cut(s) 138
MboI GATC 1 cut(s) 136
MboII GAAGA 1 cut(s) 127
MnlI CCTC 3 cut(s) 54, 68, 148
Mph1103I ATGCAT 1 cut(s) 176
MseI TTAA 1 cut(s) 223
MslI CAYNNNNRTG 1 cut(s) 179
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
NdeII GATC 1 cut(s) 136
NsiI ATGCAT 1 cut(s) 176
PfeI GAWTC 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 179
SaqAI TTAA 1 cut(s) 223
Sau3AI GATC 1 cut(s) 136
ScrFI CCNGG 1 cut(s) 48
SetI ASST 2 cut(s) 10, 171
SfaNI GCATC 1 cut(s) 61
SgeI CNNG 6 cut(s) 59, 60, 75, 83, 110, 166
SmiMI CAYNNNNRTG 1 cut(s) 179
SspMI CTAG 1 cut(s) 63
StyD4I CCNGG 1 cut(s) 46
TfiI GAWTC 1 cut(s) 30
Tru1I TTAA 1 cut(s) 223
Tru9I TTAA 1 cut(s) 223
TspDTI ATGAA 2 cut(s) 17, 22
XspI CTAG 1 cut(s) 63
Zsp2I ATGCAT 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.