Rorug02G0297500

Late embryogenesis abundant protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
33013497 .. 33014445
949 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0297500.1

Sequence Viewer

Length: 201 bp
ATGGCTATTTTTTCAGCTCTTCTCAGTTGCTTCATTCCCTCATCATCGTCACAGGTTTCTGATGCTGCAGGAAATGCCAGTATTGCAAAAGCTCCTTCCTCAAAGGATTCCAGGAAAAGCAACTCTTTGAAATCATCGTCATCGGGAGCTCCCATAGTAGTTTCACACTTCCCCCATAACTCGTATATCTCTCGTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

6.79

Weight (kDa)

9.86

Isoelectric Point (pI)

58.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015961)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 130
AjnI CCWGG 1 cut(s) 110
AluBI AGCT 3 cut(s) 17, 92, 149
AluI AGCT 3 cut(s) 17, 92, 149
Alw21I GWGCWC 1 cut(s) 151
ApeKI GCWGC 1 cut(s) 65
BanII GRGCYC 1 cut(s) 151
Bbv12I GWGCWC 1 cut(s) 151
BbvI GCAGC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 112
BfmI CTRYAG 1 cut(s) 66
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 112
BmsI GCATC 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 112
BseMII CTCAG 1 cut(s) 37
BseNI ACTGG 1 cut(s) 78
BseXI GCAGC 1 cut(s) 52
BsiHKAI GWGCWC 1 cut(s) 151
Bsp1286I GDGCHC 1 cut(s) 151
BspCNI CTCAG 1 cut(s) 36
BspMAI CTGCAG 1 cut(s) 70
BspQI GCTCTTC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 24
BstAPI GCANNNNNTGC 1 cut(s) 74
BstDEI CTNAG 1 cut(s) 23
BstMWI GCNNNNNNNGC 2 cut(s) 74, 83
BstNI CCWGG 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 110
BstSFI CTRYAG 1 cut(s) 66
BstV1I GCAGC 1 cut(s) 52
CviJI RGCY 4 cut(s) 5, 17, 92, 149
CviKI_1 RGCY 4 cut(s) 5, 17, 92, 149
DdeI CTNAG 1 cut(s) 23
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Ecl136II GAGCTC 1 cut(s) 149
Eco24I GRGCYC 1 cut(s) 151
Eco53kI GAGCTC 1 cut(s) 149
EcoICRI GAGCTC 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 110
EcoT38I GRGCYC 1 cut(s) 151
FaiI YATR 3 cut(s) 155, 177, 186
FalI AAGNNNNNCTT 2 cut(s) 109, 141
Fnu4HI GCNGC 1 cut(s) 66
FriOI GRGCYC 1 cut(s) 151
Fsp4HI GCNGC 1 cut(s) 66
GluI GCNGC 1 cut(s) 66
HinfI GANTC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 144
HpyAV CCTTC 1 cut(s) 105
HpyCH4V TGCA 2 cut(s) 68, 86
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 83
HpyF3I CTNAG 1 cut(s) 23
LguI GCTCTTC 1 cut(s) 24
LmnI GCTCC 3 cut(s) 97, 146, 154
LpnPI CCDG 5 cut(s) 38, 54, 91, 97, 124
Lsp1109I GCAGC 1 cut(s) 52
LweI GCATC 1 cut(s) 52
MaeIII GTNAC 1 cut(s) 48
MboII GAAGA 1 cut(s) 11
MhlI GDGCHC 1 cut(s) 151
MnlI CCTC 2 cut(s) 49, 109
MspR9I CCNGG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 112
MwoI GCNNNNNNNGC 2 cut(s) 74, 83
NmuCI GTSAC 1 cut(s) 48
PciSI GCTCTTC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 107
PfoI TCCNGGA 1 cut(s) 110
PkrI GCNGC 1 cut(s) 67
Psp124BI GAGCTC 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PstI CTGCAG 1 cut(s) 70
SacI GAGCTC 1 cut(s) 151
SapI GCTCTTC 1 cut(s) 24
SatI GCNGC 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 112
SduI GDGCHC 1 cut(s) 151
SetI ASST 4 cut(s) 19, 57, 94, 151
SfaNI GCATC 1 cut(s) 52
SfcI CTRYAG 1 cut(s) 66
SgeI CNNG 7 cut(s) 65, 81, 90, 123, 124, 156, 193
SstI GAGCTC 1 cut(s) 151
StyD4I CCNGG 1 cut(s) 110
TfiI GAWTC 1 cut(s) 107
TseFI GTSAC 1 cut(s) 48
TseI GCWGC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 48
TspDTI ATGAA 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.