Rorug02G0408900

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
52174033 .. 52179626
5594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0408900.1

Sequence Viewer

Length: 183 bp
ATGCTCAAGATGGCCTATGTTAACGATTCTTTGATTCTCAAAGGTAAATTTGGAATTCCGAAACAGATCGTTCTCCTGTCAAATTCTGGTTGTGAATTTGGTTTTGTGAATGGTGATCGGAAGCTTGAAGTTGTGTGGTTGATTATTCTGGATATGCAGATAATTGATTCCATTGAAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.77

Weight (kDa)

5.04

Isoelectric Point (pI)

31.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014616)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G16770 AT1G16770 AT1G16770
fragaria_vesca FvH4_6g36570
malus_domestica MD17G1161100.v1.1
prunus_persica Prupe.3G025300_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0149061
rosa_laevigata RLG00000020365
rosa_multiflora Rmu_sc0007360.1_g000002
rosa_roxburghii Rroxscaffold_2G00098510
rosa_rugosa Rorug02G0408900 Rorug02G0409000
rosa_samantha Rh2AG468300 Rh2BG481000 Rh2CG454500 Rh2DG489800
rosa_wichuraiana Rw2G038140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 47, 54, 82, 95
AgsI TTSAA 2 cut(s) 128, 176
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
AoxI GGCC 1 cut(s) 12
ApoI RAATTY 4 cut(s) 47, 54, 82, 95
AsuHPI GGTGA 1 cut(s) 125
BccI CCATC 1 cut(s) 4
BshFI GGCC 1 cut(s) 14
BsnI GGCC 1 cut(s) 14
Bsp143I GATC 2 cut(s) 66, 115
BspANI GGCC 1 cut(s) 14
BssMI GATC 2 cut(s) 66, 115
BstKTI GATC 2 cut(s) 69, 118
BstMBI GATC 2 cut(s) 66, 115
BsuRI GGCC 1 cut(s) 14
CviJI RGCY 2 cut(s) 14, 124
CviKI_1 RGCY 2 cut(s) 14, 124
DpnI GATC 2 cut(s) 68, 117
DpnII GATC 2 cut(s) 66, 115
EcoRI GAATTC 1 cut(s) 54
FaiI YATR 3 cut(s) 18, 155, 181
HaeIII GGCC 1 cut(s) 14
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
HindIII AAGCTT 1 cut(s) 122
HinfI GANTC 3 cut(s) 26, 34, 167
HpaI GTTAAC 1 cut(s) 22
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 2 cut(s) 60, 120
Hpy188III TCNNGA 2 cut(s) 7, 149
Hpy8I GTNNAC 1 cut(s) 22
HpyCH4V TGCA 1 cut(s) 157
KspAI GTTAAC 1 cut(s) 22
Kzo9I GATC 2 cut(s) 66, 115
LpnPI CCDG 3 cut(s) 72, 89, 134
MalI GATC 2 cut(s) 68, 117
MboI GATC 2 cut(s) 66, 115
MluCI AATT 5 cut(s) 47, 54, 82, 95, 162
MseI TTAA 1 cut(s) 21
NdeII GATC 2 cut(s) 66, 115
PfeI GAWTC 3 cut(s) 26, 34, 167
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 2 cut(s) 66, 115
SetI ASST 2 cut(s) 46, 126
SgeI CNNG 5 cut(s) 19, 88, 99, 137, 161
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 5 cut(s) 47, 54, 82, 95, 162
TasI AATT 5 cut(s) 47, 54, 82, 95, 162
TfiI GAWTC 3 cut(s) 26, 34, 167
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
XapI RAATTY 4 cut(s) 47, 54, 82, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.