Rorug02G0487000

Protein of unknown function (DUF789)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
61670818 .. 61671453
636 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0487000.1

Sequence Viewer

Length: 342 bp
ATGCCCTTGTCTACAGCGACTTTGGAGACAATAGTGTACTCTAGCAACTGCTATTATTTACAGGGAATTGTGATTTTCGGAATCACAGTTCATGTTCAGACCTTAGTAGTAAGAACAAAAGGCCCAGTTTTCATGACAGCTTTTAGACCACTAGCTACCATTGTTGTAGCTATAATGGGACAACACATTTTAGGAGAAGCTATATACTTGGGAAGTGTTTTGGGAGCTTTCTTGATAGTTCTTGGTCTGTATGCAACTCTTTGGGGAAAGAAAAAAGAGGAGAAGAAGTCAATGGATCATGCTATATCTCAGCAAGCTAATGAGATCAACCTAGAAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.41

Weight (kDa)

8.76

Isoelectric Point (pI)

31.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014776)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 11
AclWI GGATC 1 cut(s) 303
AfaI GTAC 1 cut(s) 38
AloI GAACNNNNNNTCC 2 cut(s) 72, 104
AluBI AGCT 6 cut(s) 140, 155, 170, 200, 227, 317
AluI AGCT 6 cut(s) 140, 155, 170, 200, 227, 317
Alw26I GTCTC 1 cut(s) 20
AlwI GGATC 1 cut(s) 303
AoxI GGCC 1 cut(s) 121
AspS9I GGNCC 1 cut(s) 122
BcoDI GTCTC 1 cut(s) 20
BfaI CTAG 3 cut(s) 42, 152, 332
BfmI CTRYAG 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 122
BmrI ACTGGG 1 cut(s) 119
BmuI ACTGGG 1 cut(s) 119
BsaXI ACNNNNNCTCC 2 cut(s) 272, 302
Bse1I ACTGG 1 cut(s) 125
BseMII CTCAG 1 cut(s) 323
BseNI ACTGG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 293
BshFI GGCC 1 cut(s) 123
BslFI GGGAC 1 cut(s) 192
BsmAI GTCTC 1 cut(s) 20
BsmFI GGGAC 1 cut(s) 192
BsnI GGCC 1 cut(s) 123
Bsp143I GATC 2 cut(s) 295, 324
BspANI GGCC 1 cut(s) 123
BspCNI CTCAG 1 cut(s) 322
BspHI TCATGA 1 cut(s) 132
BspPI GGATC 1 cut(s) 303
BsrI ACTGG 1 cut(s) 125
BssMI GATC 2 cut(s) 295, 324
Bst4CI ACNGT 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 315
BstDEI CTNAG 2 cut(s) 103, 309
BstKTI GATC 2 cut(s) 298, 327
BstMAI GTCTC 1 cut(s) 20
BstMBI GATC 2 cut(s) 295, 324
BstSFI CTRYAG 1 cut(s) 12
BsuRI GGCC 1 cut(s) 123
Cac8I GCNNGC 1 cut(s) 315
CciI TCATGA 1 cut(s) 132
Cfr13I GGNCC 1 cut(s) 122
Csp6I GTAC 1 cut(s) 37
CviAII CATG 3 cut(s) 92, 133, 299
CviJI RGCY 7 cut(s) 123, 140, 155, 170, 200, 227, 317
CviKI_1 RGCY 7 cut(s) 123, 140, 155, 170, 200, 227, 317
CviQI GTAC 1 cut(s) 37
DdeI CTNAG 2 cut(s) 103, 309
DpnI GATC 2 cut(s) 297, 326
DpnII GATC 2 cut(s) 295, 324
FaeI CATG 3 cut(s) 95, 136, 302
FaiI YATR 8 cut(s) 93, 134, 173, 203, 205, 252, 300, 305
FaqI GGGAC 1 cut(s) 192
FatI CATG 3 cut(s) 91, 132, 298
FblI GTMKAC 1 cut(s) 11
FspBI CTAG 3 cut(s) 42, 152, 332
HaeIII GGCC 1 cut(s) 123
Hin1II CATG 3 cut(s) 95, 136, 302
HinfI GANTC 1 cut(s) 81
Hpy166II GTNNAC 2 cut(s) 12, 37
Hpy188I TCNGA 2 cut(s) 80, 99
Hpy188III TCNNGA 2 cut(s) 133, 232
Hpy8I GTNNAC 2 cut(s) 12, 37
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4V TGCA 1 cut(s) 254
HpyF3I CTNAG 2 cut(s) 103, 309
Hsp92II CATG 3 cut(s) 95, 136, 302
Kzo9I GATC 2 cut(s) 295, 324
LmnI GCTCC 1 cut(s) 224
LpnPI CCDG 2 cut(s) 47, 138
MaeI CTAG 3 cut(s) 42, 152, 332
MalI GATC 2 cut(s) 297, 326
MboI GATC 2 cut(s) 295, 324
MboII GAAGA 1 cut(s) 295
MluCI AATT 1 cut(s) 66
MnlI CCTC 1 cut(s) 271
NdeII GATC 2 cut(s) 295, 324
NlaIII CATG 3 cut(s) 95, 136, 302
PagI TCATGA 1 cut(s) 132
PfeI GAWTC 1 cut(s) 81
PspPI GGNCC 1 cut(s) 122
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
Sau3AI GATC 2 cut(s) 295, 324
Sau96I GGNCC 1 cut(s) 122
SetI ASST 8 cut(s) 104, 142, 157, 172, 202, 229, 319, 333
SfcI CTRYAG 1 cut(s) 12
Sse9I AATT 1 cut(s) 66
SspMI CTAG 3 cut(s) 42, 152, 332
TaaI ACNGT 1 cut(s) 88
TasI AATT 1 cut(s) 66
TatI WGTACW 1 cut(s) 36
TfiI GAWTC 1 cut(s) 81
TspDTI ATGAA 2 cut(s) 80, 121
XmiI GTMKAC 1 cut(s) 11
XspI CTAG 3 cut(s) 42, 152, 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.