Rorug03G0153700

deoxyribonuclease

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
12644740 .. 12645081
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0153700.1

Sequence Viewer

Length: 339 bp
ATGCAATTTGAACAGGAGGGTGTCCTGAAATTATTGCTCTACTGCATATATGATGCAGCACTGCTAGCTAAGACATGGAAGAAGGTTAGGTTTCAGGAGTTGAAAGGCAGAAGACATCAATGCACTTCTGAAGCCTTTGCTGAATCCTCTGTTGCCACCTTTCTGTTGCGGCACAGTCGTCTTCCAGCTTTTGAAGCTAATCGAACCACCAACTTGGTAAACTCAGTAGCTATTTTAGCTATGATCTTGCCTCTCTTTGGAGGAAGCCTGAGCTTGATTGTGTTTGAAGGCTTGGATTTTGCAATAGATACAGCCATTGCTTTGGAATTTTCGAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.51

Weight (kDa)

6.72

Isoelectric Point (pI)

38.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AcsI RAATTY 1 cut(s) 326
AcuI CTGAAG 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 257
AgsI TTSAA 4 cut(s) 11, 103, 194, 287
AluBI AGCT 6 cut(s) 68, 188, 197, 230, 239, 273
AluI AGCT 6 cut(s) 68, 188, 197, 230, 239, 273
ApeKI GCWGC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 326
AsuNHI GCTAGC 1 cut(s) 64
BbsI GAAGAC 2 cut(s) 118, 173
BbvI GCAGC 1 cut(s) 68
BfaI CTAG 1 cut(s) 65
BisI GCNGC 2 cut(s) 57, 170
BlsI GCNGC 2 cut(s) 58, 171
BmsI GCATC 1 cut(s) 43
BmtI GCTAGC 1 cut(s) 68
BpiI GAAGAC 2 cut(s) 118, 173
Bpu10I CCTNAGC 1 cut(s) 269
Bsc4I CCNNNNNNNGG 1 cut(s) 257
Bse3DI GCAATG 1 cut(s) 315
BseLI CCNNNNNNNGG 1 cut(s) 257
BseMI GCAATG 1 cut(s) 315
BseMII CTCAG 2 cut(s) 237, 260
BseXI GCAGC 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 257
Bsp143I GATC 1 cut(s) 243
BspACI CCGC 1 cut(s) 169
BspCNI CTCAG 2 cut(s) 236, 261
BspOI GCTAGC 1 cut(s) 68
BsrDI GCAATG 1 cut(s) 315
BssMI GATC 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 176
BstC8I GCNNGC 1 cut(s) 66
BstDEI CTNAG 3 cut(s) 69, 223, 269
BstKTI GATC 1 cut(s) 246
BstMBI GATC 1 cut(s) 243
BstMWI GCNNNNNNNGC 3 cut(s) 65, 194, 236
BstV1I GCAGC 1 cut(s) 68
BstV2I GAAGAC 2 cut(s) 118, 173
BstXI CCANNNNNNTGG 2 cut(s) 214, 322
BtsI GCAGTG 1 cut(s) 59
BtsIMutI CAGTG 1 cut(s) 59
Cac8I GCNNGC 1 cut(s) 66
CviAII CATG 1 cut(s) 75
DdeI CTNAG 3 cut(s) 69, 223, 269
DpnI GATC 1 cut(s) 245
DpnII GATC 1 cut(s) 243
Eco57I CTGAAG 1 cut(s) 150
FaeI CATG 1 cut(s) 78
FaiI YATR 5 cut(s) 47, 49, 51, 76, 242
FatI CATG 1 cut(s) 74
Fnu4HI GCNGC 2 cut(s) 57, 170
Fsp4HI GCNGC 2 cut(s) 57, 170
FspBI CTAG 1 cut(s) 65
GluI GCNGC 2 cut(s) 57, 170
Hin1II CATG 1 cut(s) 78
HinfI GANTC 1 cut(s) 143
Hpy166II GTNNAC 1 cut(s) 220
Hpy188I TCNGA 1 cut(s) 130
Hpy188III TCNNGA 2 cut(s) 25, 95
Hpy8I GTNNAC 1 cut(s) 220
HpyAV CCTTC 2 cut(s) 76, 281
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 5 cut(s) 4, 45, 56, 123, 302
HpyF10VI GCNNNNNNNGC 3 cut(s) 65, 194, 236
HpyF3I CTNAG 3 cut(s) 69, 223, 269
Hsp92II CATG 1 cut(s) 78
Kzo9I GATC 1 cut(s) 243
LpnPI CCDG 4 cut(s) 38, 80, 198, 281
Lsp1109I GCAGC 1 cut(s) 68
LweI GCATC 1 cut(s) 43
MaeI CTAG 1 cut(s) 65
MalI GATC 1 cut(s) 245
MboI GATC 1 cut(s) 243
MboII GAAGA 3 cut(s) 91, 123, 173
MluCI AATT 3 cut(s) 5, 29, 326
MnlI CCTC 4 cut(s) 10, 157, 254, 261
MwoI GCNNNNNNNGC 3 cut(s) 65, 194, 236
NdeII GATC 1 cut(s) 243
NheI GCTAGC 1 cut(s) 64
NlaIII CATG 1 cut(s) 78
PfeI GAWTC 1 cut(s) 143
PkrI GCNGC 2 cut(s) 58, 171
SatI GCNGC 2 cut(s) 57, 170
Sau3AI GATC 1 cut(s) 243
SetI ASST 9 cut(s) 70, 87, 92, 161, 190, 199, 232, 241, 275
SfaNI GCATC 1 cut(s) 43
Sse9I AATT 3 cut(s) 5, 29, 326
SsiI CCGC 1 cut(s) 169
SspMI CTAG 1 cut(s) 65
TaaI ACNGT 1 cut(s) 176
TaqI TCGA 2 cut(s) 202, 332
TasI AATT 3 cut(s) 5, 29, 326
TauI GCSGC 1 cut(s) 172
TfiI GAWTC 1 cut(s) 143
TscAI CASTG 1 cut(s) 66
TseI GCWGC 1 cut(s) 56
TspRI CASTG 1 cut(s) 66
XapI RAATTY 1 cut(s) 326
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.