Rorug03G0320400

Guanine nucleotide-binding protein subunit gamma

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
34626093 .. 34626275
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0320400.1

Sequence Viewer

Length: 183 bp
ATGGAGGAAGCAACAAAGCAGCCGGGAGTAGTGCTAACAAGCTTTACAGGGGGGCGGAGCAGTACCAGGTGGACTCCCACTACAGATCAGATAAGAATCCTCAAGGAGCTTTACTACTACAAGGGAGTTAGGTCCCCAACTGCAGAGCAGATTCAGAGGATCTGTCAGCTGAAATGGTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

7.01

Weight (kDa)

9.58

Isoelectric Point (pI)

60.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012824)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 55
AclWI GGATC 1 cut(s) 167
AfaI GTAC 2 cut(s) 64, 179
AjnI CCWGG 1 cut(s) 65
AluBI AGCT 3 cut(s) 42, 109, 169
AluI AGCT 3 cut(s) 42, 109, 169
AlwI GGATC 1 cut(s) 167
ApeKI GCWGC 1 cut(s) 19
AspS9I GGNCC 1 cut(s) 132
AsuC2I CCSGG 1 cut(s) 24
AvaII GGWCC 1 cut(s) 132
BbvI GCAGC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 67
BcnI CCSGG 1 cut(s) 24
BfmI CTRYAG 2 cut(s) 81, 141
BisI GCNGC 1 cut(s) 20
BlsI GCNGC 1 cut(s) 21
Bme1390I CCNGG 2 cut(s) 24, 67
Bme18I GGWCC 1 cut(s) 132
BmgT120I GGNCC 1 cut(s) 132
BmiI GGNNCC 1 cut(s) 134
BmrFI CCNGG 2 cut(s) 24, 67
BpuEI CTTGAG 1 cut(s) 86
BpuMI CCSGG 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 95
Bse8I GATNNNNATC 1 cut(s) 95
BseBI CCWGG 1 cut(s) 67
BseJI GATNNNNATC 1 cut(s) 95
BseXI GCAGC 1 cut(s) 31
BsiSI CCGG 1 cut(s) 23
BslFI GGGAC 1 cut(s) 118
BsmFI GGGAC 1 cut(s) 118
Bsp143I GATC 2 cut(s) 85, 159
BspACI CCGC 1 cut(s) 55
BspLI GGNNCC 1 cut(s) 134
BspMAI CTGCAG 1 cut(s) 145
BspPI GGATC 1 cut(s) 167
BssMI GATC 2 cut(s) 85, 159
Bst2UI CCWGG 1 cut(s) 67
BstKTI GATC 2 cut(s) 88, 162
BstMBI GATC 2 cut(s) 85, 159
BstNI CCWGG 1 cut(s) 67
BstSCI CCNGG 2 cut(s) 22, 65
BstSFI CTRYAG 2 cut(s) 81, 141
BstV1I GCAGC 1 cut(s) 31
BstX2I RGATCY 1 cut(s) 159
BstYI RGATCY 1 cut(s) 159
Cfr13I GGNCC 1 cut(s) 132
CsiI ACCWGGT 1 cut(s) 65
Csp6I GTAC 2 cut(s) 63, 178
CviJI RGCY 4 cut(s) 22, 42, 109, 169
CviKI_1 RGCY 4 cut(s) 22, 42, 109, 169
CviQI GTAC 2 cut(s) 63, 178
DpnI GATC 2 cut(s) 87, 161
DpnII GATC 2 cut(s) 85, 159
EciI GGCGGA 1 cut(s) 70
Eco47I GGWCC 1 cut(s) 132
EcoO109I RGGNCCY 1 cut(s) 132
EcoRII CCWGG 1 cut(s) 65
FaqI GGGAC 1 cut(s) 118
Fnu4HI GCNGC 1 cut(s) 20
Fsp4HI GCNGC 1 cut(s) 20
GluI GCNGC 1 cut(s) 20
HapII CCGG 1 cut(s) 23
HindIII AAGCTT 1 cut(s) 40
HinfI GANTC 3 cut(s) 73, 96, 151
HpaII CCGG 1 cut(s) 23
Hpy166II GTNNAC 1 cut(s) 72
Hpy188I TCNGA 2 cut(s) 90, 156
Hpy8I GTNNAC 1 cut(s) 72
HpyCH4V TGCA 1 cut(s) 143
Kzo9I GATC 2 cut(s) 85, 159
LmnI GCTCC 2 cut(s) 57, 106
LpnPI CCDG 4 cut(s) 33, 36, 52, 79
Lsp1109I GCAGC 1 cut(s) 31
MabI ACCWGGT 1 cut(s) 65
MalI GATC 2 cut(s) 87, 161
MboI GATC 2 cut(s) 85, 159
MflI RGATCY 1 cut(s) 159
MlyI GAGTC 1 cut(s) 67
MnlI CCTC 2 cut(s) 110, 150
MspA1I CMGCKG 1 cut(s) 169
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 2 cut(s) 24, 67
MvaI CCWGG 1 cut(s) 67
NciI CCSGG 1 cut(s) 24
NdeII GATC 2 cut(s) 85, 159
NlaIV GGNNCC 1 cut(s) 134
PfeI GAWTC 2 cut(s) 96, 151
PkrI GCNGC 1 cut(s) 21
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
PpuMI RGGWCCY 1 cut(s) 132
Psp5II RGGWCCY 1 cut(s) 132
Psp6I CCWGG 1 cut(s) 65
PspGI CCWGG 1 cut(s) 65
PspN4I GGNNCC 1 cut(s) 134
PspPI GGNCC 1 cut(s) 132
PspPPI RGGWCCY 1 cut(s) 132
PstI CTGCAG 1 cut(s) 145
PsuI RGATCY 1 cut(s) 159
PvuII CAGCTG 1 cut(s) 169
RsaI GTAC 2 cut(s) 64, 179
RsaNI GTAC 2 cut(s) 63, 178
SatI GCNGC 1 cut(s) 20
Sau3AI GATC 2 cut(s) 85, 159
Sau96I GGNCC 1 cut(s) 132
SchI GAGTC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 24, 67
SetI ASST 5 cut(s) 44, 71, 111, 134, 171
SexAI ACCWGGT 1 cut(s) 65
SfcI CTRYAG 2 cut(s) 81, 141
SgeI CNNG 8 cut(s) 35, 36, 51, 60, 78, 79, 115, 133
SinI GGWCC 1 cut(s) 132
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
SsiI CCGC 1 cut(s) 55
StyD4I CCNGG 2 cut(s) 22, 65
TfiI GAWTC 2 cut(s) 96, 151
TseI GCWGC 1 cut(s) 19
VpaK11BI GGWCC 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.