Rorug04G0029700

Belongs to the sodium solute symporter (SSF) (TC 2.A.21) family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
4184216 .. 4184368
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0029700.1

Sequence Viewer

Length: 153 bp
ATGCAAAACTGGTGCATCTGCCCCCTAGTGATTCTGATCACGTCCCAATTCTTCTGCATGCGAGTAAGGTTCCTATTCCGCAAAGAACTCGGTTTCATAGGTTTAAGTTTGAAGCCTTTTGGCTTTAGCACCCTAAGTGTGATCCATTGGTGA

Protein Analysis

50

Amino Acids

5.93

Weight (kDa)

9.61

Isoelectric Point (pI)

23.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AclWI GGATC 1 cut(s) 136
AgsI TTSAA 1 cut(s) 112
AjiI CACGTC 1 cut(s) 42
AlwI GGATC 1 cut(s) 136
BcgI CGANNNNNNTGC 2 cut(s) 70, 104
BclI TGATCA 1 cut(s) 36
BfaI CTAG 1 cut(s) 26
BmgBI CACGTC 1 cut(s) 42
BmiI GGNNCC 1 cut(s) 71
BmsI GCATC 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 14
Bse8I GATNNNNATC 1 cut(s) 35
BseJI GATNNNNATC 1 cut(s) 35
BseNI ACTGG 1 cut(s) 14
BslFI GGGAC 1 cut(s) 28
BsmFI GGGAC 1 cut(s) 28
Bsp143I GATC 2 cut(s) 36, 141
BspACI CCGC 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 71
BspPI GGATC 1 cut(s) 136
BsrI ACTGG 1 cut(s) 14
BssMI GATC 2 cut(s) 36, 141
BstC8I GCNNGC 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 134
BstKTI GATC 2 cut(s) 39, 144
BstMBI GATC 2 cut(s) 36, 141
BstNSI RCATGY 1 cut(s) 61
BtrI CACGTC 1 cut(s) 42
Cac8I GCNNGC 1 cut(s) 59
CviAII CATG 1 cut(s) 58
CviJI RGCY 2 cut(s) 115, 123
CviKI_1 RGCY 2 cut(s) 115, 123
DdeI CTNAG 1 cut(s) 134
DpnI GATC 2 cut(s) 38, 143
DpnII GATC 2 cut(s) 36, 141
FaeI CATG 1 cut(s) 61
FaiI YATR 2 cut(s) 59, 98
FaqI GGGAC 1 cut(s) 28
FatI CATG 1 cut(s) 57
FbaI TGATCA 1 cut(s) 36
FspBI CTAG 1 cut(s) 26
Hin1II CATG 1 cut(s) 61
HinfI GANTC 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 36
HpyCH4IV ACGT 1 cut(s) 41
HpyCH4V TGCA 3 cut(s) 4, 15, 57
HpyF3I CTNAG 1 cut(s) 134
HpySE526I ACGT 1 cut(s) 41
Hsp92II CATG 1 cut(s) 61
Ksp22I TGATCA 1 cut(s) 36
Kzo9I GATC 2 cut(s) 36, 141
LweI GCATC 1 cut(s) 24
MaeI CTAG 1 cut(s) 26
MaeII ACGT 1 cut(s) 41
MalI GATC 2 cut(s) 38, 143
MboI GATC 2 cut(s) 36, 141
MboII GAAGA 1 cut(s) 43
MluCI AATT 1 cut(s) 47
MseI TTAA 1 cut(s) 104
NdeII GATC 2 cut(s) 36, 141
NlaIII CATG 1 cut(s) 61
NlaIV GGNNCC 1 cut(s) 71
NspI RCATGY 1 cut(s) 61
PaeI GCATGC 1 cut(s) 61
PfeI GAWTC 1 cut(s) 31
PspN4I GGNNCC 1 cut(s) 71
SaqAI TTAA 1 cut(s) 104
Sau3AI GATC 2 cut(s) 36, 141
SetI ASST 3 cut(s) 44, 71, 103
SfaNI GCATC 1 cut(s) 24
SgeI CNNG 6 cut(s) 22, 38, 52, 70, 74, 101
SphI GCATGC 1 cut(s) 61
Sse9I AATT 1 cut(s) 47
SsiI CCGC 1 cut(s) 79
SspMI CTAG 1 cut(s) 26
TaiI ACGT 1 cut(s) 44
TasI AATT 1 cut(s) 47
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TspDTI ATGAA 1 cut(s) 85
XceI RCATGY 1 cut(s) 61
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.