Rorug04G0057200
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
8963996 .. 8964151
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0057200.1

Sequence Viewer

Length: 156 bp
ATGCTAAGGAAATTCTCAATGACTTACAATGCTTGGAGGAAAATTGGTCAGTTGAAGGTGCTCTTATTGAAGAAGTTAAATCTTTGTTTTGTTTCTTTTGTTAAGTTTATTGTACTTTTGCCCCATGTGATTATAATCGGGCGGCGTACCTTCTAG

Protein Analysis

51

Amino Acids

6.09

Weight (kDa)

11.62

Isoelectric Point (pI)

19.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014140)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G23950 AT4G30520
fragaria_vesca FvH4_4g08870 FvH4_4g08870
malus_domestica MD16G1259200.v1.1
prunus_persica Prupe.1G100800_v2.0.a1
pyrus_communis pycom16g22670
rosa_chinensis RchiOBHm_Chr4g0405301
rosa_laevigata RLG00000008859
rosa_multiflora Rmu_sc0000161.1_g000017
rosa_roxburghii Rroxscaffold_5G00349670
rosa_rugosa Rorug04G0057100 Rorug04G0057200
rosa_samantha Rh4AG130600 Rh4CG137500 Rh4DG124000
rosa_wichuraiana Rw4G010570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 134
AciI CCGC 1 cut(s) 142
AcsI RAATTY 1 cut(s) 11
AfaI GTAC 2 cut(s) 114, 148
AgsI TTSAA 2 cut(s) 55, 70
Alw21I GWGCWC 1 cut(s) 63
ApoI RAATTY 1 cut(s) 11
Bbv12I GWGCWC 1 cut(s) 63
BfaI CTAG 1 cut(s) 154
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
Bpu10I CCTNAGC 1 cut(s) 5
BsaBI GATNNNNATC 1 cut(s) 134
Bse8I GATNNNNATC 1 cut(s) 134
BseJI GATNNNNATC 1 cut(s) 134
BsiHKAI GWGCWC 1 cut(s) 63
Bsp1286I GDGCHC 1 cut(s) 63
BspACI CCGC 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 5
Csp6I GTAC 2 cut(s) 113, 147
CviAII CATG 1 cut(s) 125
CviQI GTAC 2 cut(s) 113, 147
DdeI CTNAG 1 cut(s) 5
FaeI CATG 1 cut(s) 128
FaiI YATR 2 cut(s) 126, 134
FalI AAGNNNNNCTT 2 cut(s) 47, 79
FatI CATG 1 cut(s) 124
Fnu4HI GCNGC 1 cut(s) 143
Fsp4HI GCNGC 1 cut(s) 143
FspBI CTAG 1 cut(s) 154
GluI GCNGC 1 cut(s) 143
Hin1II CATG 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 49
HpyF3I CTNAG 1 cut(s) 5
Hsp92II CATG 1 cut(s) 128
MaeI CTAG 1 cut(s) 154
MboII GAAGA 1 cut(s) 82
MhlI GDGCHC 1 cut(s) 63
MluCI AATT 2 cut(s) 11, 42
MnlI CCTC 1 cut(s) 30
MseI TTAA 2 cut(s) 77, 102
NlaIII CATG 1 cut(s) 128
PkrI GCNGC 1 cut(s) 144
PsiI TTATAA 1 cut(s) 134
RsaI GTAC 2 cut(s) 114, 148
RsaNI GTAC 2 cut(s) 113, 147
SaqAI TTAA 2 cut(s) 77, 102
SatI GCNGC 1 cut(s) 143
SduI GDGCHC 1 cut(s) 63
SetI ASST 2 cut(s) 60, 152
SgeI CNNG 3 cut(s) 45, 137, 151
Sse9I AATT 2 cut(s) 11, 42
SsiI CCGC 1 cut(s) 142
SspMI CTAG 1 cut(s) 154
TasI AATT 2 cut(s) 11, 42
TatI WGTACW 1 cut(s) 112
TauI GCSGC 1 cut(s) 145
Tru1I TTAA 2 cut(s) 77, 102
Tru9I TTAA 2 cut(s) 77, 102
XapI RAATTY 1 cut(s) 11
XspI CTAG 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.