Rorug04G0209700

30S ribosomal protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0013214
Physical Location & Seq
Reverse (-)
36530478 .. 36530937
460 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0209700.1

Sequence Viewer

Length: 348 bp
ATGCGTTTCTTAGTGATAGCTTTCTTGATGCCTAGGTGGTTCGCAAAGCGTTTCTTACATCGTGATATAGTTGATCAATATAGTCGCATTCTTCTACGGGATGAGGACCTTGGAGTTGACAATTTCAATCCTCAACGGTATGTGTCCATTGTTCGAAAGGAAGGGCTTGAAATATCACAACCGGCACTTGATTTTTTCAAGACAGAGGTGAACTACATGGAGAAACTTTCAAAAGATGAGGGGATTCAGAAGAAACTCAGCAAGGATATTTTGCAATATAAAGCTCATATAATCAAGATATTTGTGGAACATAGGCACAATTGGATCTCTGCAGATTTAGAGTTTTAG

Protein Analysis

115

Amino Acids

13.9

Weight (kDa)

8.89

Isoelectric Point (pI)

36.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF707 PF05212 13 - 83 1.9e-25 Protein of unknown function (DUF707)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013214)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G30510
fragaria_vesca FvH4_4g20780 FvH4_4g20780
malus_domestica MD13G1147900.v1.1 MD16G1147700.v1.1
prunus_persica Prupe.1G111400_v2.0.a1
pyrus_communis pycom16g12610 pycom16g12620
rosa_chinensis RchiOBHm_Chr4g0426221
rosa_laevigata RLG00000007309
rosa_multiflora Rmu_sc0000730.1_g000026
rosa_roxburghii Rroxscaffold_5G00368240
rosa_rugosa Rorug04G0209700
rosa_samantha Rh4AG266600 Rh4BG272600 Rh4CG285800 Rh4DG268900
rosa_wichuraiana Rw4G023050

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 332
AgsI TTSAA 4 cut(s) 127, 170, 199, 231
AluBI AGCT 2 cut(s) 20, 284
AluI AGCT 2 cut(s) 20, 284
AlwI GGATC 1 cut(s) 332
AspA2I CCTAGG 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 106
AsuHPI GGTGA 1 cut(s) 220
AsuII TTCGAA 1 cut(s) 154
AvaII GGWCC 1 cut(s) 106
AvrII CCTAGG 1 cut(s) 32
BclI TGATCA 1 cut(s) 73
BfaI CTAG 1 cut(s) 33
BfmI CTRYAG 1 cut(s) 330
BlnI CCTAGG 1 cut(s) 32
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmsI GCATC 1 cut(s) 18
Bpu14I TTCGAA 1 cut(s) 154
BsaJI CCNNGG 2 cut(s) 32, 109
Bse118I RCCGGY 1 cut(s) 181
BseDI CCNNGG 2 cut(s) 32, 109
BseGI GGATG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 271
BsiSI CCGG 1 cut(s) 182
BsmI GAATGC 1 cut(s) 87
Bsp119I TTCGAA 1 cut(s) 154
Bsp143I GATC 2 cut(s) 73, 324
BspCNI CTCAG 1 cut(s) 270
BspMAI CTGCAG 1 cut(s) 334
BspPI GGATC 1 cut(s) 332
BspT104I TTCGAA 1 cut(s) 154
BsrFI RCCGGY 1 cut(s) 181
BssAI RCCGGY 1 cut(s) 181
BssECI CCNNGG 2 cut(s) 32, 109
BssMI GATC 2 cut(s) 73, 324
BssT1I CCWWGG 2 cut(s) 32, 109
Bst4CI ACNGT 1 cut(s) 138
BstBI TTCGAA 1 cut(s) 154
BstDEI CTNAG 2 cut(s) 10, 257
BstF5I GGATG 1 cut(s) 106
BstKTI GATC 2 cut(s) 76, 327
BstMBI GATC 2 cut(s) 73, 324
BstSFI CTRYAG 1 cut(s) 330
BstX2I RGATCY 1 cut(s) 324
BstYI RGATCY 1 cut(s) 324
BtsCI GGATG 1 cut(s) 106
Cfr10I RCCGGY 1 cut(s) 181
Cfr13I GGNCC 1 cut(s) 106
CviAII CATG 1 cut(s) 217
CviJI RGCY 3 cut(s) 20, 166, 284
CviKI_1 RGCY 3 cut(s) 20, 166, 284
DdeI CTNAG 2 cut(s) 10, 257
DpnI GATC 2 cut(s) 75, 326
DpnII GATC 2 cut(s) 73, 324
Eco130I CCWWGG 2 cut(s) 32, 109
Eco47I GGWCC 1 cut(s) 106
EcoO109I RGGNCCY 1 cut(s) 106
EcoT14I CCWWGG 2 cut(s) 32, 109
ErhI CCWWGG 2 cut(s) 32, 109
FaeI CATG 1 cut(s) 220
FaiI YATR 8 cut(s) 68, 81, 141, 218, 279, 288, 290, 312
FalI AAGNNNNNCTT 2 cut(s) 38, 70
FatI CATG 1 cut(s) 216
FbaI TGATCA 1 cut(s) 73
FokI GGATG 1 cut(s) 113
FspBI CTAG 1 cut(s) 33
HapII CCGG 1 cut(s) 182
Hin1II CATG 1 cut(s) 220
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HinfI GANTC 1 cut(s) 244
HpaII CCGG 1 cut(s) 182
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 2 cut(s) 118, 211
Hpy188I TCNGA 1 cut(s) 249
Hpy188III TCNNGA 4 cut(s) 25, 62, 199, 295
Hpy8I GTNNAC 2 cut(s) 118, 211
HpyAV CCTTC 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 138
HpyCH4V TGCA 2 cut(s) 274, 332
HpyF3I CTNAG 2 cut(s) 10, 257
Hsp92II CATG 1 cut(s) 220
Ksp22I TGATCA 1 cut(s) 73
Kzo9I GATC 2 cut(s) 73, 324
LpnPI CCDG 1 cut(s) 195
LweI GCATC 1 cut(s) 18
MaeI CTAG 1 cut(s) 33
MalI GATC 2 cut(s) 75, 326
MboI GATC 2 cut(s) 73, 324
MboII GAAGA 2 cut(s) 83, 262
MfeI CAATTG 1 cut(s) 319
MflI RGATCY 1 cut(s) 324
MluCI AATT 2 cut(s) 121, 319
MnlI CCTC 4 cut(s) 97, 141, 199, 232
MspI CCGG 1 cut(s) 182
MunI CAATTG 1 cut(s) 319
Mva1269I GAATGC 1 cut(s) 87
NdeII GATC 2 cut(s) 73, 324
NlaIII CATG 1 cut(s) 220
NspV TTCGAA 1 cut(s) 154
PctI GAATGC 1 cut(s) 87
PfeI GAWTC 1 cut(s) 244
PpuMI RGGWCCY 1 cut(s) 106
Psp5II RGGWCCY 1 cut(s) 106
PspPI GGNCC 1 cut(s) 106
PspPPI RGGWCCY 1 cut(s) 106
PstI CTGCAG 1 cut(s) 334
PsuI RGATCY 1 cut(s) 324
Sau3AI GATC 2 cut(s) 73, 324
Sau96I GGNCC 1 cut(s) 106
SetI ASST 5 cut(s) 22, 38, 111, 210, 286
SfaNI GCATC 1 cut(s) 18
SfcI CTRYAG 1 cut(s) 330
SfuI TTCGAA 1 cut(s) 154
SinI GGWCC 1 cut(s) 106
Sse9I AATT 2 cut(s) 121, 319
SspMI CTAG 1 cut(s) 33
StyI CCWWGG 2 cut(s) 32, 109
TaaI ACNGT 1 cut(s) 138
TaqI TCGA 1 cut(s) 154
TasI AATT 2 cut(s) 121, 319
TfiI GAWTC 1 cut(s) 244
VpaK11BI GGWCC 1 cut(s) 106
XmaJI CCTAGG 1 cut(s) 32
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.