Rorug05G0274100

cyclin-dependent protein kinase inhibitor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0012953
Physical Location & Seq
Reverse (-)
30952614 .. 30954010
1397 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0274100.1

Sequence Viewer

Length: 558 bp
ATGGAGGATCACGAATCTCCCCAAGCTGCTAGAGTTAAAGTATTGGCAAGTGGAAATGCAACAGAAAGGCGATTCAGTGTTTGGATAGGTGGCAGTATATTGGCTTCTCTTGGTTCATTCCAGCAGATGTGGTTCTCCAAGGCTGATTTGGACGAAATGTCCAAACTACCCTCTTCTCCTCTCTCCTCTCCTAAATCCCACAACCCTCTCTCTAACCCTAAAAACCCAGATCTCTTTGCAGCTCCGCTCAACCGCCACCATAAGCGCAACCACATCCGCTCAACCGCCACCATGAACGCAACCCAATCCTCCTCTCCTACCTCACTTCCTACTCTCAATCCTCTTCACCATCAAAACCAGTCTCCGACTACACTCTCTCTTTCTCTCTGTTCTCCCTCATCTTCCAATCTCCCCAAACCCACCATCTCTGTCCTCTCCAAAGGCATTCCCACCACCACCCAAACCATCAAAACCATATTTCACTTCATGTTCGCCACCCAAAATCAAAATCATAAAAAGCATCCAATCCAACCCGACCTTGTGATAAAACCCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

185

Amino Acids

20.34

Weight (kDa)

10.29

Isoelectric Point (pI)

57.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Actin PF00022 6 - 53 4.7e-16 Actin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012953)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G51355 AT3G20898
fragaria_vesca FvH4_3g28800
malus_domestica MD03G1174700.v1.1 MD11G1192700.v1.1
prunus_persica Prupe.4G249800_v2.0.a1
pyrus_communis pycom03g13210 pycom11g16830
rosa_chinensis RchiOBHm_Chr5g0052211
rosa_laevigata RLG00000034836
rosa_multiflora Rmu_sc0006157.1_g000012
rosa_roxburghii Rroxscaffold_1G00028030
rosa_rugosa Rorug05G0274100
rosa_samantha Rh5AG346600 Rh5BG357200 Rh5CG382800 Rh5DG372700
rosa_wichuraiana Rw5G032730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 247, 279
AciI CCGC 4 cut(s) 245, 253, 277, 285
AclWI GGATC 1 cut(s) 15
AhdI GACNNNNNGTC 1 cut(s) 157
AluBI AGCT 2 cut(s) 26, 242
AluI AGCT 2 cut(s) 26, 242
Alw26I GTCTC 1 cut(s) 366
AlwI GGATC 1 cut(s) 15
ApeKI GCWGC 2 cut(s) 26, 239
AspLEI GCGC 1 cut(s) 267
AsuHPI GGTGA 1 cut(s) 338
BarI GAAGNNNNNNTAC 2 cut(s) 88, 120
BbvI GCAGC 2 cut(s) 13, 251
BccI CCATC 3 cut(s) 357, 431, 473
BcoDI GTCTC 1 cut(s) 366
BfaI CTAG 1 cut(s) 30
BglII AGATCT 1 cut(s) 229
BisI GCNGC 2 cut(s) 27, 240
BlsI GCNGC 2 cut(s) 28, 241
BmeRI GACNNNNNGTC 1 cut(s) 157
BmsI GCATC 1 cut(s) 529
BsaJI CCNNGG 1 cut(s) 138
Bse1I ACTGG 1 cut(s) 358
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 2 cut(s) 273, 520
BseNI ACTGG 1 cut(s) 358
BseRI GAGGAG 3 cut(s) 168, 175, 301
BseXI GCAGC 2 cut(s) 13, 251
BsmAI GTCTC 1 cut(s) 366
BsmI GAATGC 1 cut(s) 444
Bsp143I GATC 2 cut(s) 7, 229
BspACI CCGC 4 cut(s) 245, 253, 277, 285
BspPI GGATC 1 cut(s) 15
BsrBI CCGCTC 2 cut(s) 247, 279
BsrI ACTGG 1 cut(s) 358
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 2 cut(s) 7, 229
BssT1I CCWWGG 1 cut(s) 138
Bst6I CTCTTC 2 cut(s) 178, 348
BstF5I GGATG 2 cut(s) 273, 520
BstHHI GCGC 1 cut(s) 267
BstKTI GATC 2 cut(s) 10, 232
BstMAI GTCTC 1 cut(s) 366
BstMBI GATC 2 cut(s) 7, 229
BstV1I GCAGC 2 cut(s) 13, 251
BstX2I RGATCY 1 cut(s) 229
BstYI RGATCY 1 cut(s) 229
BtsCI GGATG 2 cut(s) 273, 520
BtsIMutI CAGTG 1 cut(s) 82
CfoI GCGC 1 cut(s) 267
CviAII CATG 2 cut(s) 292, 487
CviJI RGCY 4 cut(s) 26, 104, 143, 242
CviKI_1 RGCY 4 cut(s) 26, 104, 143, 242
DpnI GATC 2 cut(s) 9, 231
DpnII GATC 2 cut(s) 7, 229
DriI GACNNNNNGTC 1 cut(s) 157
Eam1104I CTCTTC 2 cut(s) 178, 348
Eam1105I GACNNNNNGTC 1 cut(s) 157
EarI CTCTTC 2 cut(s) 178, 348
Eco130I CCWWGG 1 cut(s) 138
EcoT14I CCWWGG 1 cut(s) 138
ErhI CCWWGG 1 cut(s) 138
FaeI CATG 2 cut(s) 295, 490
FaiI YATR 6 cut(s) 98, 261, 293, 476, 488, 513
FatI CATG 2 cut(s) 291, 486
Fnu4HI GCNGC 2 cut(s) 27, 240
FokI GGATG 2 cut(s) 260, 507
Fsp4HI GCNGC 2 cut(s) 27, 240
FspBI CTAG 1 cut(s) 30
GlaI GCGC 1 cut(s) 266
GluI GCNGC 2 cut(s) 27, 240
HhaI GCGC 1 cut(s) 267
Hin1II CATG 2 cut(s) 295, 490
Hin6I GCGC 1 cut(s) 265
HinP1I GCGC 1 cut(s) 265
HinfI GANTC 2 cut(s) 14, 72
HphI GGTGA 1 cut(s) 338
Hpy188I TCNGA 1 cut(s) 366
Hpy188III TCNNGA 1 cut(s) 11
HpyCH4V TGCA 2 cut(s) 59, 239
Hsp92II CATG 2 cut(s) 295, 490
HspAI GCGC 1 cut(s) 265
Kzo9I GATC 2 cut(s) 7, 229
LmnI GCTCC 1 cut(s) 247
LpnPI CCDG 3 cut(s) 134, 240, 371
Lsp1109I GCAGC 2 cut(s) 13, 251
LweI GCATC 1 cut(s) 529
MaeI CTAG 1 cut(s) 30
MalI GATC 2 cut(s) 9, 231
MbiI CCGCTC 2 cut(s) 247, 279
MboI GATC 2 cut(s) 7, 229
MboII GAAGA 3 cut(s) 165, 335, 393
MflI RGATCY 1 cut(s) 229
MmeI TCCRAC 2 cut(s) 389, 553
MseI TTAA 1 cut(s) 36
Mva1269I GAATGC 1 cut(s) 444
NdeII GATC 2 cut(s) 7, 229
NlaIII CATG 2 cut(s) 295, 490
PctI GAATGC 1 cut(s) 444
PfeI GAWTC 2 cut(s) 14, 72
PkrI GCNGC 2 cut(s) 28, 241
PsuI RGATCY 1 cut(s) 229
SaqAI TTAA 1 cut(s) 36
SatI GCNGC 2 cut(s) 27, 240
Sau3AI GATC 2 cut(s) 7, 229
SetI ASST 5 cut(s) 28, 91, 244, 323, 540
SfaNI GCATC 1 cut(s) 529
SsiI CCGC 4 cut(s) 245, 253, 277, 285
SspMI CTAG 1 cut(s) 30
StyI CCWWGG 1 cut(s) 138
TfiI GAWTC 2 cut(s) 14, 72
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TscAI CASTG 1 cut(s) 82
TseI GCWGC 2 cut(s) 26, 239
TspDTI ATGAA 3 cut(s) 105, 308, 475
TspRI CASTG 1 cut(s) 82
XcmI CCANNNNNNNNNTGG 1 cut(s) 145
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.