Rorug06G0224100

Receptor-like cytosolic serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
35791985 .. 35794289
2305 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0224100.1

Sequence Viewer

Length: 543 bp
ATGCTAGCTTTCATGTTTGTTCTGATCCATTCTACAGGTCATGGAGGCTCAAGAACTGCAAAATACCTGAAAGAGAACCTTTTCAACAATTTAAGTGGTCACCCAGAATTTATCAAAGACACAAAGATAGCTATTGTTGAAGTATTTAAACAGACAGATGTTGAATACATCAATGAAGAGAAAGGTGATCAAAAAGACACTGGCTCAACTGCATCAACCGCTTTGTTGTTAGGGGATCGGCTTTTCATTGCAAATGTTGGTGATTCAAGAGTAGTCGCCGGGAGAGCTGGTTCAGCTATCACCTTGTCCAATGACCATAAACCTGATAGATCTGACAAACGTCAAAGAATTGAAGAGGCCGGAGGTTTTGTTATGTGGGCAGGAACATGGAGGGTTGGTGGTGTTCTTGCTGTTTCCCGTTCATTTGGTGACAAAGAAGAAGAGATTAATGGCGTAGATTTCATAATTATCGCAAGTGATAGACTTTGGAATGTCATATCAAACAATGTGAGTGCAAGCATTAAATTATTTTTTCTCTCATAA

Protein Analysis

180

Amino Acids

19.78

Weight (kDa)

6.09

Isoelectric Point (pI)

25.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2C PF00481 12 - 146 4.1e-33 Protein phosphatase 2C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 219
AclWI GGATC 2 cut(s) 19, 243
AcsI RAATTY 1 cut(s) 107
AgsI TTSAA 5 cut(s) 85, 140, 164, 267, 353
AloI GAACNNNNNNTCC 2 cut(s) 274, 306
AluBI AGCT 4 cut(s) 8, 131, 287, 296
AluI AGCT 4 cut(s) 8, 131, 287, 296
AlwI GGATC 2 cut(s) 19, 243
AoxI GGCC 1 cut(s) 357
ApoI RAATTY 1 cut(s) 107
AseI ATTAAT 1 cut(s) 447
Asp700I GAANNNNTTC 1 cut(s) 80
AsuC2I CCSGG 1 cut(s) 280
AsuHPI GGTGA 5 cut(s) 92, 197, 272, 292, 440
AsuNHI GCTAGC 1 cut(s) 4
BclI TGATCA 1 cut(s) 187
BcnI CCSGG 1 cut(s) 280
BfaI CTAG 1 cut(s) 5
BfmI CTRYAG 1 cut(s) 33
BglII AGATCT 1 cut(s) 329
Bme1390I CCNGG 1 cut(s) 280
BmrFI CCNGG 1 cut(s) 280
BmsI GCATC 1 cut(s) 221
BmtI GCTAGC 1 cut(s) 8
BoxI GACNNNNGTC 1 cut(s) 339
BpuEI CTTGAG 1 cut(s) 34
BpuMI CCSGG 1 cut(s) 280
BsaXI ACNNNNNCTCC 6 cut(s) 274, 304, 354, 382, 384, 412
Bse1I ACTGG 1 cut(s) 205
Bse3DI GCAATG 1 cut(s) 246
BseMI GCAATG 1 cut(s) 246
BseNI ACTGG 1 cut(s) 205
BshFI GGCC 1 cut(s) 359
BsiSI CCGG 2 cut(s) 279, 360
BsnI GGCC 1 cut(s) 359
Bsp143I GATC 4 cut(s) 24, 187, 235, 329
BspACI CCGC 1 cut(s) 219
BspANI GGCC 1 cut(s) 359
BspOI GCTAGC 1 cut(s) 8
BspPI GGATC 2 cut(s) 19, 243
BsrDI GCAATG 1 cut(s) 246
BsrI ACTGG 1 cut(s) 205
BssMI GATC 4 cut(s) 24, 187, 235, 329
Bst6I CTCTTC 3 cut(s) 171, 348, 435
BstC8I GCNNGC 2 cut(s) 6, 517
BstEII GGTNACC 1 cut(s) 98
BstKTI GATC 4 cut(s) 27, 190, 238, 332
BstMBI GATC 4 cut(s) 24, 187, 235, 329
BstMWI GCNNNNNNNGC 3 cut(s) 218, 284, 293
BstPAI GACNNNNGTC 1 cut(s) 339
BstPI GGTNACC 1 cut(s) 98
BstSCI CCNGG 1 cut(s) 278
BstSFI CTRYAG 1 cut(s) 33
BstX2I RGATCY 1 cut(s) 329
BstYI RGATCY 1 cut(s) 329
BsuRI GGCC 1 cut(s) 359
BtsIMutI CAGTG 1 cut(s) 198
Cac8I GCNNGC 2 cut(s) 6, 517
CspCI CAANNNNNGTGG 2 cut(s) 76, 111
CviAII CATG 3 cut(s) 13, 41, 387
CviJI RGCY 8 cut(s) 8, 48, 131, 204, 241, 287, 296, 359
CviKI_1 RGCY 8 cut(s) 8, 48, 131, 204, 241, 287, 296, 359
DpnI GATC 4 cut(s) 26, 189, 237, 331
DpnII GATC 4 cut(s) 24, 187, 235, 329
DraI TTTAAA 1 cut(s) 148
Eam1104I CTCTTC 3 cut(s) 171, 348, 435
EarI CTCTTC 3 cut(s) 171, 348, 435
Eco91I GGTNACC 1 cut(s) 98
EcoO65I GGTNACC 1 cut(s) 98
FaeI CATG 3 cut(s) 16, 44, 390
FaiI YATR 8 cut(s) 14, 42, 318, 374, 388, 464, 497, 541
FalI AAGNNNNNCTT 2 cut(s) 63, 95
FatI CATG 3 cut(s) 12, 40, 386
FbaI TGATCA 1 cut(s) 187
FspBI CTAG 1 cut(s) 5
HaeIII GGCC 1 cut(s) 359
HapII CCGG 2 cut(s) 279, 360
Hin1II CATG 3 cut(s) 16, 44, 390
HinfI GANTC 1 cut(s) 263
HpaII CCGG 2 cut(s) 279, 360
HphI GGTGA 5 cut(s) 92, 197, 272, 292, 440
Hpy188I TCNGA 2 cut(s) 24, 334
Hpy188III TCNNGA 2 cut(s) 51, 267
HpyCH4IV ACGT 1 cut(s) 340
HpyCH4V TGCA 4 cut(s) 59, 212, 251, 515
HpyF10VI GCNNNNNNNGC 3 cut(s) 218, 284, 293
HpySE526I ACGT 1 cut(s) 340
Hsp92II CATG 3 cut(s) 16, 44, 390
Ksp22I TGATCA 1 cut(s) 187
Kzo9I GATC 4 cut(s) 24, 187, 235, 329
LpnPI CCDG 9 cut(s) 21, 80, 117, 186, 273, 292, 336, 366, 373
LweI GCATC 1 cut(s) 221
MaeI CTAG 1 cut(s) 5
MaeII ACGT 1 cut(s) 340
MaeIII GTNAC 2 cut(s) 98, 428
MalI GATC 4 cut(s) 26, 189, 237, 331
MboI GATC 4 cut(s) 24, 187, 235, 329
MboII GAAGA 4 cut(s) 188, 365, 449, 452
MflI RGATCY 1 cut(s) 329
MluCI AATT 5 cut(s) 88, 107, 348, 465, 524
MnlI CCTC 4 cut(s) 38, 349, 356, 384
MroXI GAANNNNTTC 1 cut(s) 80
MseI TTAA 4 cut(s) 92, 147, 447, 522
MspI CCGG 2 cut(s) 279, 360
MspR9I CCNGG 1 cut(s) 280
MwoI GCNNNNNNNGC 3 cut(s) 218, 284, 293
NciI CCSGG 1 cut(s) 280
NdeII GATC 4 cut(s) 24, 187, 235, 329
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 3 cut(s) 16, 44, 390
NmuCI GTSAC 2 cut(s) 98, 428
PdmI GAANNNNTTC 1 cut(s) 80
PfeI GAWTC 1 cut(s) 263
PshAI GACNNNNGTC 1 cut(s) 339
PshBI ATTAAT 1 cut(s) 447
PspEI GGTNACC 1 cut(s) 98
PsuI RGATCY 1 cut(s) 329
SaqAI TTAA 4 cut(s) 92, 147, 447, 522
Sau3AI GATC 4 cut(s) 24, 187, 235, 329
ScrFI CCNGG 1 cut(s) 280
SfaNI GCATC 1 cut(s) 221
SfcI CTRYAG 1 cut(s) 33
SmlI CTYRAG 1 cut(s) 49
SmoI CTYRAG 1 cut(s) 49
Sse9I AATT 5 cut(s) 88, 107, 348, 465, 524
SsiI CCGC 1 cut(s) 219
SspMI CTAG 1 cut(s) 5
StyD4I CCNGG 1 cut(s) 278
TaiI ACGT 1 cut(s) 343
TasI AATT 5 cut(s) 88, 107, 348, 465, 524
TfiI GAWTC 1 cut(s) 263
Tru1I TTAA 4 cut(s) 92, 147, 447, 522
Tru9I TTAA 4 cut(s) 92, 147, 447, 522
TscAI CASTG 1 cut(s) 205
TseFI GTSAC 2 cut(s) 98, 428
Tsp45I GTSAC 2 cut(s) 98, 428
TspDTI ATGAA 4 cut(s) 189, 235, 411, 451
TspRI CASTG 1 cut(s) 205
VspI ATTAAT 1 cut(s) 447
XapI RAATTY 1 cut(s) 107
XmnI GAANNNNTTC 1 cut(s) 80
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.