Rorug06G0349100

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0009762
Physical Location & Seq
Reverse (-)
49912257 .. 49912952
696 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0349100.1

Sequence Viewer

Length: 213 bp
ATGGACGGGCACGATTCGGAGGATTCGAAGCAGAGCACTGCTGATATGTCTGCTTTTGTGCAAAATCTGCTTCAACAGATGCAAACTAGGTTCCAATCGATGTCTGACAACATTGTTACAAAGAATATCCTTTTCTCTGATTCTTCAAGTTATAAGCAATCATCTTTGTATGCTAGGGTGTACATTGCCGAAGTTGTTTCACTAGTTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.89

Weight (kDa)

4.65

Isoelectric Point (pI)

90.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSBP1 PF06825 15 - 41 4.8e-11 Heat shock factor binding protein 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 153
AfaI GTAC 1 cut(s) 182
AgsI TTSAA 2 cut(s) 74, 147
AhlI ACTAGT 1 cut(s) 202
Alw21I GWGCWC 1 cut(s) 38
AsuII TTCGAA 1 cut(s) 26
BaeGI GKGCMC 1 cut(s) 12
Bbv12I GWGCWC 1 cut(s) 38
BcuI ACTAGT 1 cut(s) 202
BfaI CTAG 3 cut(s) 87, 174, 203
BmiI GGNNCC 1 cut(s) 92
BmsI GCATC 1 cut(s) 69
Bpu14I TTCGAA 1 cut(s) 26
Bsa29I ATCGAT 1 cut(s) 98
Bse3DI GCAATG 1 cut(s) 183
BseCI ATCGAT 1 cut(s) 98
BseMI GCAATG 1 cut(s) 183
BseSI GKGCMC 1 cut(s) 12
BshVI ATCGAT 1 cut(s) 98
BsiHKAI GWGCWC 1 cut(s) 38
Bsp119I TTCGAA 1 cut(s) 26
Bsp1286I GDGCHC 2 cut(s) 12, 38
Bsp1407I TGTACA 1 cut(s) 180
BspDI ATCGAT 1 cut(s) 98
BspLI GGNNCC 1 cut(s) 92
BspT104I TTCGAA 1 cut(s) 26
BsrDI GCAATG 1 cut(s) 183
BsrGI TGTACA 1 cut(s) 180
BstAPI GCANNNNNTGC 1 cut(s) 67
BstAUI TGTACA 1 cut(s) 180
BstBI TTCGAA 1 cut(s) 26
BstMWI GCNNNNNNNGC 1 cut(s) 67
BstSLI GKGCMC 1 cut(s) 12
Bsu15I ATCGAT 1 cut(s) 98
BsuTUI ATCGAT 1 cut(s) 98
BtsI GCAGTG 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 36
ClaI ATCGAT 1 cut(s) 98
Csp6I GTAC 1 cut(s) 181
CviQI GTAC 1 cut(s) 181
FaiI YATR 4 cut(s) 47, 153, 171, 211
FspBI CTAG 3 cut(s) 87, 174, 203
FspEI CC 8 cut(s) 2, 5, 73, 107, 143, 160, 161, 202
HinfI GANTC 3 cut(s) 14, 23, 140
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 3 cut(s) 19, 106, 139
Hpy8I GTNNAC 1 cut(s) 181
HpyCH4V TGCA 2 cut(s) 61, 82
HpyF10VI GCNNNNNNNGC 1 cut(s) 67
LweI GCATC 1 cut(s) 69
MaeI CTAG 3 cut(s) 87, 174, 203
MaeIII GTNAC 1 cut(s) 115
MboII GAAGA 1 cut(s) 135
MhlI GDGCHC 2 cut(s) 12, 38
MnlI CCTC 1 cut(s) 13
MwoI GCNNNNNNNGC 1 cut(s) 67
NlaIV GGNNCC 1 cut(s) 92
NspV TTCGAA 1 cut(s) 26
PcsI WCGNNNNNNNCGW 1 cut(s) 23
PfeI GAWTC 3 cut(s) 14, 23, 140
PsiI TTATAA 1 cut(s) 153
PspN4I GGNNCC 1 cut(s) 92
RsaI GTAC 1 cut(s) 182
RsaNI GTAC 1 cut(s) 181
SduI GDGCHC 2 cut(s) 12, 38
SetI ASST 1 cut(s) 92
SfaNI GCATC 1 cut(s) 69
SfuI TTCGAA 1 cut(s) 26
SgeI CNNG 5 cut(s) 19, 23, 99, 159, 186
SpeI ACTAGT 1 cut(s) 202
SspMI CTAG 3 cut(s) 87, 174, 203
TaqI TCGA 2 cut(s) 26, 98
TatI WGTACW 1 cut(s) 180
TfiI GAWTC 3 cut(s) 14, 23, 140
TscAI CASTG 1 cut(s) 43
TspRI CASTG 1 cut(s) 43
XspI CTAG 3 cut(s) 87, 174, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.