Rorug07G0246700
ERF Family

Transmembrane 9 superfamily member

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0005262
Physical Location & Seq
Reverse (-)
22835405 .. 22836063
659 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0246700.1

Sequence Viewer

Length: 252 bp
ATGGGTTTCCGATTGCCTCGAATTGCCAACACAAAGAAAGCAGATATCCCAAAAGGCCACTTTGTGGTATATGTTGGACAGAGCCAGAAGAAACGATTTGTGGTTCCAATATCATATTTGAACCAACCTTTGTTTCAGAGTTTGCTGAGTCAAGCTGAAGAAGAATTCGGATACCATCATCCAATGGGTGGTATCACAATTCCTTGCAGTCAAGACACCTTCCTTGATGTCACTTTCCGCCTTAGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EMP70

Protein Analysis

83

Amino Acids

9.43

Weight (kDa)

9.3

Isoelectric Point (pI)

38.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 10 - 78 4.5e-25 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 64, 188
AciI CCGC 1 cut(s) 238
AcsI RAATTY 1 cut(s) 164
AcuI CTGAAG 1 cut(s) 177
AdeI CACNNNGTG 1 cut(s) 64
AfiI CCNNNNNNNGG 2 cut(s) 64, 188
AgsI TTSAA 1 cut(s) 121
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
AoxI GGCC 1 cut(s) 55
ApoI RAATTY 1 cut(s) 164
BccI CCATC 1 cut(s) 183
BciVI GTATCC 1 cut(s) 164
BfuI GTATCC 1 cut(s) 164
BmiI GGNNCC 1 cut(s) 105
Bsc4I CCNNNNNNNGG 2 cut(s) 64, 188
BseGI GGATG 1 cut(s) 178
BseLI CCNNNNNNNGG 2 cut(s) 64, 188
BseMII CTCAG 1 cut(s) 137
BshFI GGCC 1 cut(s) 57
BslI CCNNNNNNNGG 2 cut(s) 64, 188
BsnI GGCC 1 cut(s) 57
BspACI CCGC 1 cut(s) 238
BspANI GGCC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 105
BstDEI CTNAG 2 cut(s) 146, 242
BstF5I GGATG 1 cut(s) 178
BsuI GTATCC 1 cut(s) 164
BsuRI GGCC 1 cut(s) 57
BtsCI GGATG 1 cut(s) 178
CviJI RGCY 3 cut(s) 57, 84, 155
CviKI_1 RGCY 3 cut(s) 57, 84, 155
DdeI CTNAG 2 cut(s) 146, 242
DraIII CACNNNGTG 1 cut(s) 64
EciI GGCGGA 1 cut(s) 227
Eco32I GATATC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 177
EcoRI GAATTC 1 cut(s) 164
EcoRV GATATC 1 cut(s) 46
FaiI YATR 3 cut(s) 70, 72, 115
FokI GGATG 1 cut(s) 165
HaeIII GGCC 1 cut(s) 57
HinfI GANTC 1 cut(s) 148
Hpy188I TCNGA 3 cut(s) 11, 138, 170
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 229
HpyCH4V TGCA 1 cut(s) 207
HpyF3I CTNAG 2 cut(s) 146, 242
LpnPI CCDG 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 229
MboII GAAGA 3 cut(s) 100, 170, 173
MluCI AATT 3 cut(s) 21, 164, 198
MlyI GAGTC 1 cut(s) 157
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 1 cut(s) 27
NlaIV GGNNCC 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 229
PflMI CCANNNNNTGG 2 cut(s) 64, 188
PleI GAGTC 1 cut(s) 156
PpsI GAGTC 1 cut(s) 156
PspN4I GGNNCC 1 cut(s) 105
SchI GAGTC 1 cut(s) 157
SetI ASST 3 cut(s) 130, 157, 221
SgeI CNNG 6 cut(s) 30, 97, 164, 216, 224, 236
Sse9I AATT 3 cut(s) 21, 164, 198
SsiI CCGC 1 cut(s) 238
TaqI TCGA 1 cut(s) 19
TasI AATT 3 cut(s) 21, 164, 198
TseFI GTSAC 1 cut(s) 229
Tsp45I GTSAC 1 cut(s) 229
Van91I CCANNNNNTGG 2 cut(s) 64, 188
XapI RAATTY 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.