Rh1AG040000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0018256
Physical Location & Seq
Reverse (-)
7026546 .. 7041152
14607 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG040000.1

Sequence Viewer

Length: 189 bp
ATGAGATCCAGGTCCAGAGAGTTGGATCTCTATCTTCAAGCACATCGACTTTATCTCCATCAACTCATCACTGTTGTCCACCTCGCCGTACTCGTCGTCAGAGCAGGCTCGCTTAAGGACCTTAAGCACGGCCTTCTTGGTCTCCTCGACCTTGACGAGCACGATCTCAATGCTTTGGTTGATGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.04

Weight (kDa)

6.48

Isoelectric Point (pI)

24.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 33
AfaI GTAC 1 cut(s) 90
AflII CTTAAG 2 cut(s) 113, 122
AgsI TTSAA 1 cut(s) 38
AjnI CCWGG 1 cut(s) 8
Alw21I GWGCWC 1 cut(s) 162
Alw26I GTCTC 1 cut(s) 146
AlwI GGATC 1 cut(s) 33
AoxI GGCC 1 cut(s) 130
AspS9I GGNCC 2 cut(s) 12, 118
AvaII GGWCC 2 cut(s) 12, 118
Bbv12I GWGCWC 1 cut(s) 162
BccI CCATC 1 cut(s) 66
BceAI ACGGC 2 cut(s) 71, 145
BcgI CGANNNNNNTGC 2 cut(s) 152, 186
BciT130I CCWGG 1 cut(s) 10
BcoDI GTCTC 1 cut(s) 146
BfrI CTTAAG 2 cut(s) 113, 122
Bme1390I CCNGG 1 cut(s) 10
Bme18I GGWCC 2 cut(s) 12, 118
BmgT120I GGNCC 2 cut(s) 12, 118
BmrFI CCNGG 1 cut(s) 10
BmsI GCATC 1 cut(s) 172
BsaBI GATNNNNATC 1 cut(s) 30
BsaI GGTCTC 1 cut(s) 146
BsaXI ACNNNNNCTCC 2 cut(s) 39, 69
Bse8I GATNNNNATC 1 cut(s) 30
BseBI CCWGG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 30
BseRI GAGGAG 1 cut(s) 134
BshFI GGCC 1 cut(s) 132
BsiHKAI GWGCWC 1 cut(s) 162
BsmAI GTCTC 1 cut(s) 146
BsnI GGCC 1 cut(s) 132
Bso31I GGTCTC 1 cut(s) 146
Bsp1286I GDGCHC 1 cut(s) 162
Bsp143I GATC 3 cut(s) 5, 25, 163
BspANI GGCC 1 cut(s) 132
BspPI GGATC 1 cut(s) 33
BspTI CTTAAG 2 cut(s) 113, 122
BspTNI GGTCTC 1 cut(s) 146
BssMI GATC 3 cut(s) 5, 25, 163
Bst2UI CCWGG 1 cut(s) 10
Bst4CI ACNGT 1 cut(s) 73
BstAFI CTTAAG 2 cut(s) 113, 122
BstC8I GCNNGC 2 cut(s) 106, 110
BstDEI CTNAG 1 cut(s) 186
BstKTI GATC 3 cut(s) 8, 28, 166
BstMAI GTCTC 1 cut(s) 146
BstMBI GATC 3 cut(s) 5, 25, 163
BstNI CCWGG 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 8
BstX2I RGATCY 2 cut(s) 5, 25
BstXI CCANNNNNNTGG 1 cut(s) 22
BstYI RGATCY 2 cut(s) 5, 25
BsuRI GGCC 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 69
Cac8I GCNNGC 2 cut(s) 106, 110
Cfr13I GGNCC 2 cut(s) 12, 118
Csp6I GTAC 1 cut(s) 89
CviJI RGCY 2 cut(s) 108, 132
CviKI_1 RGCY 2 cut(s) 108, 132
CviQI GTAC 1 cut(s) 89
DdeI CTNAG 1 cut(s) 186
DpnI GATC 3 cut(s) 7, 27, 165
DpnII GATC 3 cut(s) 5, 25, 163
Eco31I GGTCTC 1 cut(s) 146
Eco47I GGWCC 2 cut(s) 12, 118
EcoO109I RGGNCCY 1 cut(s) 118
EcoRII CCWGG 1 cut(s) 8
HaeIII GGCC 1 cut(s) 132
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 101
Hpy188III TCNNGA 1 cut(s) 15
Hpy8I GTNNAC 1 cut(s) 79
Hpy99I CGWCG 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 73
HpyF3I CTNAG 1 cut(s) 186
Kzo9I GATC 3 cut(s) 5, 25, 163
LpnPI CCDG 3 cut(s) 22, 28, 90
LweI GCATC 1 cut(s) 172
MalI GATC 3 cut(s) 7, 27, 165
MboI GATC 3 cut(s) 5, 25, 163
MboII GAAGA 1 cut(s) 26
MflI RGATCY 2 cut(s) 5, 25
MhlI GDGCHC 1 cut(s) 162
MnlI CCTC 2 cut(s) 92, 155
MseI TTAA 2 cut(s) 114, 123
MspCI CTTAAG 2 cut(s) 113, 122
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
NdeII GATC 3 cut(s) 5, 25, 163
PcsI WCGNNNNNNNCGW 2 cut(s) 90, 153
PpuMI RGGWCCY 1 cut(s) 118
Psp5II RGGWCCY 1 cut(s) 118
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
PspPI GGNCC 2 cut(s) 12, 118
PspPPI RGGWCCY 1 cut(s) 118
PsuI RGATCY 2 cut(s) 5, 25
RsaI GTAC 1 cut(s) 90
RsaNI GTAC 1 cut(s) 89
SaqAI TTAA 2 cut(s) 114, 123
Sau3AI GATC 3 cut(s) 5, 25, 163
Sau96I GGNCC 2 cut(s) 12, 118
ScrFI CCNGG 1 cut(s) 10
SduI GDGCHC 1 cut(s) 162
SetI ASST 4 cut(s) 14, 84, 123, 153
SfaNI GCATC 1 cut(s) 172
SinI GGWCC 2 cut(s) 12, 118
SmlI CTYRAG 2 cut(s) 113, 122
SmoI CTYRAG 2 cut(s) 113, 122
StyD4I CCNGG 1 cut(s) 8
TaaI ACNGT 1 cut(s) 73
TaqI TCGA 2 cut(s) 46, 147
Tru1I TTAA 2 cut(s) 114, 123
Tru9I TTAA 2 cut(s) 114, 123
TscAI CASTG 1 cut(s) 76
TspRI CASTG 1 cut(s) 76
Vha464I CTTAAG 2 cut(s) 113, 122
VpaK11BI GGWCC 2 cut(s) 12, 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.