Rh1BG039100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
5170796 .. 5171883
1088 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG039100.1

Sequence Viewer

Length: 219 bp
ATGTGCAGTTGTTCAGGAAAGCATGATACTATCATCATCTTAGCCGTATTTATAATTACTCGGTCAAAAAATGATATTCAATACAGAAAAGCCGAAGAATGTATGTGCAACTGTTCAAGAGCCGAGGTACAAGAGGGTCATGCTAGCATAAAATCATCGACTGCCGGAGAGCAATGCCTGAGTACATCTTTGGCCGTGTTTTATAGTATCAGGCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.97

Weight (kDa)

7.62

Isoelectric Point (pI)

48.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019101)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 53
AcoI YGGCCR 1 cut(s) 192
AfaI GTAC 2 cut(s) 129, 184
AgsI TTSAA 2 cut(s) 80, 117
AoxI GGCC 1 cut(s) 192
AsuNHI GCTAGC 1 cut(s) 143
BceAI ACGGC 2 cut(s) 29, 179
BfaI CTAG 1 cut(s) 144
BmtI GCTAGC 1 cut(s) 147
BsaJI CCNNGG 1 cut(s) 123
Bse3DI GCAATG 1 cut(s) 179
BseDI CCNNGG 1 cut(s) 123
BseMI GCAATG 1 cut(s) 179
BseMII CTCAG 1 cut(s) 170
BsgI GTGCAG 1 cut(s) 25
BshFI GGCC 1 cut(s) 194
BsiSI CCGG 1 cut(s) 165
BsnI GGCC 1 cut(s) 194
BspANI GGCC 1 cut(s) 194
BspCNI CTCAG 1 cut(s) 171
BspOI GCTAGC 1 cut(s) 147
BsrDI GCAATG 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 123
Bst4CI ACNGT 1 cut(s) 113
BstC8I GCNNGC 1 cut(s) 145
BstDEI CTNAG 2 cut(s) 40, 179
BsuRI GGCC 1 cut(s) 194
Cac8I GCNNGC 1 cut(s) 145
Csp6I GTAC 2 cut(s) 128, 183
CviAII CATG 2 cut(s) 23, 140
CviJI RGCY 4 cut(s) 44, 92, 122, 194
CviKI_1 RGCY 4 cut(s) 44, 92, 122, 194
CviQI GTAC 2 cut(s) 128, 183
DdeI CTNAG 2 cut(s) 40, 179
EaeI YGGCCR 1 cut(s) 192
FaeI CATG 2 cut(s) 26, 143
FaiI YATR 6 cut(s) 24, 53, 104, 141, 149, 204
FatI CATG 2 cut(s) 22, 139
FspBI CTAG 1 cut(s) 144
HaeIII GGCC 1 cut(s) 194
HapII CCGG 1 cut(s) 165
Hin1II CATG 2 cut(s) 26, 143
HpaII CCGG 1 cut(s) 165
Hpy188III TCNNGA 2 cut(s) 15, 117
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 2 cut(s) 6, 108
HpyF3I CTNAG 2 cut(s) 40, 179
Hsp92II CATG 2 cut(s) 26, 143
LpnPI CCDG 3 cut(s) 178, 191, 196
MaeI CTAG 1 cut(s) 144
MboII GAAGA 1 cut(s) 107
MluCI AATT 1 cut(s) 54
MnlI CCTC 2 cut(s) 118, 127
MspI CCGG 1 cut(s) 165
NheI GCTAGC 1 cut(s) 143
NlaIII CATG 2 cut(s) 26, 143
NmeAIII GCCGAG 1 cut(s) 148
PsiI TTATAA 1 cut(s) 53
RsaI GTAC 2 cut(s) 129, 184
RsaNI GTAC 2 cut(s) 128, 183
SetI ASST 1 cut(s) 129
Sse9I AATT 1 cut(s) 54
SspMI CTAG 1 cut(s) 144
TaaI ACNGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 158
TaqII GACCGA 1 cut(s) 51
TasI AATT 1 cut(s) 54
TatI WGTACW 1 cut(s) 182
XspI CTAG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.