Rh1BG139500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
23261285 .. 23263865
2581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG139500.1

Sequence Viewer

Length: 243 bp
ATGGATAAAGGAGTAACCGGAAAGGAGGCCCTGAAGGAAGTGACCCGTGAGTCGCTTATTGCCATTTCTTACTCTGAACCAGAGAAGAATCTCACTTCTGATAAGTTGAATGGTGAAACTCTGGTTAAAGCAATAGATTCTGATGGAGAAGACAAGTTCAGGTCTGAACTGATCTCCATTTCCTATACGCCGTCTTCAGAATTTGAAGGCTTTCCTGTTACCAATGGTGAACTTAAGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.81

Weight (kDa)

4.69

Isoelectric Point (pI)

21.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF6865 PF21737 6 - 68 1e-25 Family of unknown function (DUF6865)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015975)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 49
AcsI RAATTY 1 cut(s) 200
AcuI CTGAAG 2 cut(s) 53, 180
AflII CTTAAG 1 cut(s) 233
AgsI TTSAA 2 cut(s) 109, 206
AoxI GGCC 1 cut(s) 27
ApoI RAATTY 1 cut(s) 200
Asp700I GAANNNNTTC 1 cut(s) 210
AspS9I GGNCC 1 cut(s) 28
AsuHPI GGTGA 2 cut(s) 125, 239
BbsI GAAGAC 2 cut(s) 156, 186
BccI CCATC 1 cut(s) 137
BceAI ACGGC 1 cut(s) 175
BfaI CTAG 1 cut(s) 241
BfrI CTTAAG 1 cut(s) 233
BmgT120I GGNCC 1 cut(s) 28
BpiI GAAGAC 2 cut(s) 156, 186
BsaWI WCCGGW 1 cut(s) 17
BshFI GGCC 1 cut(s) 29
BsiSI CCGG 1 cut(s) 18
BsnI GGCC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 171
BspANI GGCC 1 cut(s) 29
BspTI CTTAAG 1 cut(s) 233
BssMI GATC 1 cut(s) 171
BstAFI CTTAAG 1 cut(s) 233
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstV2I GAAGAC 2 cut(s) 156, 186
BsuRI GGCC 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 28
CviJI RGCY 2 cut(s) 29, 210
CviKI_1 RGCY 2 cut(s) 29, 210
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
DrdI GACNNNNNNGTC 1 cut(s) 49
DseDI GACNNNNNNGTC 1 cut(s) 49
Eco57I CTGAAG 2 cut(s) 53, 180
EcoO109I RGGNCCY 1 cut(s) 28
FaiI YATR 1 cut(s) 186
FspBI CTAG 1 cut(s) 241
HaeIII GGCC 1 cut(s) 29
HapII CCGG 1 cut(s) 18
HinfI GANTC 3 cut(s) 50, 88, 137
HpaII CCGG 1 cut(s) 18
HphI GGTGA 2 cut(s) 125, 239
Hpy166II GTNNAC 1 cut(s) 230
Hpy188I TCNGA 5 cut(s) 76, 100, 142, 166, 199
Hpy8I GTNNAC 1 cut(s) 230
HpyAV CCTTC 2 cut(s) 28, 200
Kzo9I GATC 1 cut(s) 171
LpnPI CCDG 6 cut(s) 31, 44, 93, 107, 145, 228
MaeI CTAG 1 cut(s) 241
MaeIII GTNAC 3 cut(s) 13, 40, 217
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MboII GAAGA 3 cut(s) 97, 161, 186
MluCI AATT 1 cut(s) 200
MlyI GAGTC 1 cut(s) 59
MnlI CCTC 1 cut(s) 19
MroXI GAANNNNTTC 1 cut(s) 210
MseI TTAA 2 cut(s) 126, 234
MspCI CTTAAG 1 cut(s) 233
MspI CCGG 1 cut(s) 18
NdeII GATC 1 cut(s) 171
NmuCI GTSAC 1 cut(s) 40
PdmI GAANNNNTTC 1 cut(s) 210
PfeI GAWTC 2 cut(s) 88, 137
PleI GAGTC 1 cut(s) 58
PpsI GAGTC 1 cut(s) 58
PspPI GGNCC 1 cut(s) 28
SaqAI TTAA 2 cut(s) 126, 234
Sau3AI GATC 1 cut(s) 171
Sau96I GGNCC 1 cut(s) 28
SchI GAGTC 1 cut(s) 59
SetI ASST 1 cut(s) 164
SgeI CNNG 9 cut(s) 30, 43, 57, 59, 92, 134, 166, 172, 227
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
Sse9I AATT 1 cut(s) 200
SspMI CTAG 1 cut(s) 241
TasI AATT 1 cut(s) 200
TfiI GAWTC 2 cut(s) 88, 137
Tru1I TTAA 2 cut(s) 126, 234
Tru9I TTAA 2 cut(s) 126, 234
TseFI GTSAC 1 cut(s) 40
Tsp45I GTSAC 1 cut(s) 40
Vha464I CTTAAG 1 cut(s) 233
XapI RAATTY 1 cut(s) 200
XmnI GAANNNNTTC 1 cut(s) 210
XspI CTAG 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.