Rh2AG203400

Phytosulfokines

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
20553685 .. 20554841
1157 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG203400.1

Sequence Viewer

Length: 252 bp
ATGGCCAGAGTAACTAGAGCCCTGTTCTTCATAGCACTCCTCCTCTGCTCGACTTTAGCTTCTGCAGCTAGACCAGAACCAGCTTTTTCAGCAGTAGCAACTAATTCTATGAAAACCCAATTTGGGGCTGTTGAAACACAGCAAGCTGATATTGAACAGAGCTGTGAAGGAGTTGGAGAAGAAGAGTGCTTAATGAGAAGGACTTTGGCTGCTCACATAGATTACATCTATACCCAGAAGAATAAACCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.11

Weight (kDa)

5.72

Isoelectric Point (pI)

55.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PSK PF06404 13 - 83 7.9e-17 Phytosulfokine precursor protein (PSK)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011726)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 2 cut(s) 123, 124
AgsI TTSAA 2 cut(s) 134, 155
AluBI AGCT 5 cut(s) 59, 68, 83, 146, 162
AluI AGCT 5 cut(s) 59, 68, 83, 146, 162
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 65, 209
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 22
BbvI GCAGC 2 cut(s) 77, 196
BfaI CTAG 2 cut(s) 15, 69
BfmI CTRYAG 1 cut(s) 63
BisI GCNGC 2 cut(s) 66, 210
BlsI GCNGC 2 cut(s) 67, 211
Bsc4I CCNNNNNNNGG 2 cut(s) 123, 124
BseLI CCNNNNNNNGG 2 cut(s) 123, 124
BseRI GAGGAG 2 cut(s) 29, 32
BseXI GCAGC 2 cut(s) 77, 196
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 2 cut(s) 123, 124
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 22
BspANI GGCC 1 cut(s) 5
BspMAI CTGCAG 1 cut(s) 67
Bst6I CTCTTC 1 cut(s) 177
BstC8I GCNNGC 1 cut(s) 144
BstMWI GCNNNNNNNGC 2 cut(s) 65, 89
BstSFI CTRYAG 1 cut(s) 63
BstV1I GCAGC 2 cut(s) 77, 196
BsuRI GGCC 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 144
CviJI RGCY 9 cut(s) 5, 20, 59, 68, 83, 128, 146, 162, 209
CviKI_1 RGCY 9 cut(s) 5, 20, 59, 68, 83, 128, 146, 162, 209
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 177
EarI CTCTTC 1 cut(s) 177
Eco24I GRGCYC 1 cut(s) 22
EcoT38I GRGCYC 1 cut(s) 22
FaiI YATR 4 cut(s) 32, 110, 218, 231
Fnu4HI GCNGC 2 cut(s) 66, 210
FriOI GRGCYC 1 cut(s) 22
Fsp4HI GCNGC 2 cut(s) 66, 210
FspBI CTAG 2 cut(s) 15, 69
GluI GCNGC 2 cut(s) 66, 210
HaeIII GGCC 1 cut(s) 5
HpyAV CCTTC 2 cut(s) 161, 192
HpyCH4V TGCA 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 89
LpnPI CCDG 5 cut(s) 19, 35, 87, 93, 248
Lsp1109I GCAGC 2 cut(s) 77, 196
MaeI CTAG 2 cut(s) 15, 69
MaeIII GTNAC 1 cut(s) 10
MboII GAAGA 4 cut(s) 19, 191, 194, 250
MhlI GDGCHC 1 cut(s) 22
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 103, 119
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 154
MnlI CCTC 2 cut(s) 50, 53
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 191
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 2 cut(s) 65, 89
PkrI GCNGC 2 cut(s) 67, 211
PstI CTGCAG 1 cut(s) 67
SaqAI TTAA 1 cut(s) 191
SatI GCNGC 2 cut(s) 66, 210
SduI GDGCHC 1 cut(s) 22
SetI ASST 5 cut(s) 61, 70, 85, 148, 164
SfcI CTRYAG 1 cut(s) 63
SgeI CNNG 9 cut(s) 18, 27, 34, 61, 81, 86, 92, 155, 247
Sse9I AATT 2 cut(s) 103, 119
SspMI CTAG 2 cut(s) 15, 69
TaqI TCGA 1 cut(s) 50
TasI AATT 2 cut(s) 103, 119
Tru1I TTAA 1 cut(s) 191
Tru9I TTAA 1 cut(s) 191
TseI GCWGC 2 cut(s) 65, 209
TspDTI ATGAA 2 cut(s) 19, 125
XspI CTAG 2 cut(s) 15, 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.