Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2B

Orthogroup ID

OG0011726

Physical Location & Seq

Genomic Coordinates Reverse (-)

20588769 .. 20589927

Gene Structure 1159 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2BG216300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

ATGGCCAGAGTAACTAGAGCCCTGTTCTTCATAGCACTCCTCCTCTGCTCGACTTTAGCTTCTGCAGCTAGACCAGAACCAGCTTTTTCAGCAGTAGCAACTAATTCTGTGAAAACCCAACTTGGGGCTGTTGAAACACAGCAAGCTGATATTGAACAGAGCTGTGAAGGAGTTGGAGAAGAAGAGTGCTTAATGAGAAGGACTTTGGCTGCTCACATAGATTACATCTATACCCAGAAGAATAAACCCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PSK

Protein Analysis

83

Amino Acids

9.05

Weight (kDa)

5.72

Isoelectric Point (pI)

56.35

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PSK	PF06404	13 - 83	1.2e-16	Phytosulfokine precursor protein (PSK)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011726)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G22860 AT4G37720
fragaria_vesca	FvH4_1g18100
malus_domestica	MD02G1189200.v1.1 MD15G1300000.v1.1
prunus_persica	Prupe.6G217500_v2.0.a1 Prupe.6G217500_v2.0.a1
pyrus_communis	pycom02g15340 pycom15g26260
rosa_chinensis	RchiOBHm_Chr2g0108571 RchiOBHm_Chr2g0124661
rosa_multiflora	Rmu_sc0007574.1_g000005
rosa_roxburghii	Rroxscaffold_2G00135000
rosa_rugosa	Rorug02G0154600
rosa_samantha	Rh2AG203400 Rh2BG216300 Rh2CG207300 Rh2DG210500
rosa_wichuraiana	Rw2G016260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	3
AfiI	CCNNNNNNNGG	2 cut(s)	123, 124
AgsI	TTSAA	2 cut(s)	134, 155
AluBI	AGCT	5 cut(s)	59, 68, 83, 146, 162
AluI	AGCT	5 cut(s)	59, 68, 83, 146, 162
AoxI	GGCC	1 cut(s)	3
ApeKI	GCWGC	2 cut(s)	65, 209
BalI	TGGCCA	1 cut(s)	5
BanII	GRGCYC	1 cut(s)	22
BbvI	GCAGC	2 cut(s)	77, 196
BfaI	CTAG	2 cut(s)	15, 69
BfmI	CTRYAG	1 cut(s)	63
BisI	GCNGC	2 cut(s)	66, 210
BlsI	GCNGC	2 cut(s)	67, 211
Bsc4I	CCNNNNNNNGG	2 cut(s)	123, 124
BseLI	CCNNNNNNNGG	2 cut(s)	123, 124
BseRI	GAGGAG	2 cut(s)	29, 32
BseXI	GCAGC	2 cut(s)	77, 196
BshFI	GGCC	1 cut(s)	5
BslI	CCNNNNNNNGG	2 cut(s)	123, 124
BsnI	GGCC	1 cut(s)	5
Bsp1286I	GDGCHC	1 cut(s)	22
BspANI	GGCC	1 cut(s)	5
BspMAI	CTGCAG	1 cut(s)	67
Bst6I	CTCTTC	1 cut(s)	177
BstC8I	GCNNGC	1 cut(s)	144
BstMWI	GCNNNNNNNGC	2 cut(s)	65, 89
BstSFI	CTRYAG	1 cut(s)	63
BstV1I	GCAGC	2 cut(s)	77, 196
BsuRI	GGCC	1 cut(s)	5
Cac8I	GCNNGC	1 cut(s)	144
CviJI	RGCY	9 cut(s)	5, 20, 59, 68, 83, 128, 146, 162, 209
CviKI_1	RGCY	9 cut(s)	5, 20, 59, 68, 83, 128, 146, 162, 209
EaeI	YGGCCR	1 cut(s)	3
Eam1104I	CTCTTC	1 cut(s)	177
EarI	CTCTTC	1 cut(s)	177
Eco24I	GRGCYC	1 cut(s)	22
EcoT38I	GRGCYC	1 cut(s)	22
FaiI	YATR	3 cut(s)	32, 218, 231
Fnu4HI	GCNGC	2 cut(s)	66, 210
FriOI	GRGCYC	1 cut(s)	22
Fsp4HI	GCNGC	2 cut(s)	66, 210
FspBI	CTAG	2 cut(s)	15, 69
GluI	GCNGC	2 cut(s)	66, 210
HaeIII	GGCC	1 cut(s)	5
HpyAV	CCTTC	2 cut(s)	161, 192
HpyCH4V	TGCA	1 cut(s)	65
HpyF10VI	GCNNNNNNNGC	2 cut(s)	65, 89
LpnPI	CCDG	5 cut(s)	19, 35, 87, 93, 248
Lsp1109I	GCAGC	2 cut(s)	77, 196
MaeI	CTAG	2 cut(s)	15, 69
MaeIII	GTNAC	1 cut(s)	10
MboII	GAAGA	4 cut(s)	19, 191, 194, 250
MhlI	GDGCHC	1 cut(s)	22
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	1 cut(s)	103
MluNI	TGGCCA	1 cut(s)	5
MmeI	TCCRAC	1 cut(s)	154
MnlI	CCTC	2 cut(s)	50, 53
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	1 cut(s)	191
Msp20I	TGGCCA	1 cut(s)	5
MwoI	GCNNNNNNNGC	2 cut(s)	65, 89
PkrI	GCNGC	2 cut(s)	67, 211
PstI	CTGCAG	1 cut(s)	67
SaqAI	TTAA	1 cut(s)	191
SatI	GCNGC	2 cut(s)	66, 210
SduI	GDGCHC	1 cut(s)	22
SetI	ASST	5 cut(s)	61, 70, 85, 148, 164
SfcI	CTRYAG	1 cut(s)	63
Sse9I	AATT	1 cut(s)	103
SspMI	CTAG	2 cut(s)	15, 69
TaqI	TCGA	1 cut(s)	50
TasI	AATT	1 cut(s)	103
Tru1I	TTAA	1 cut(s)	191
Tru9I	TTAA	1 cut(s)	191
TseI	GCWGC	2 cut(s)	65, 209
TspDTI	ATGAA	1 cut(s)	19
XspI	CTAG	2 cut(s)	15, 69

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.