Rh2AG285900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
34953988 .. 34958420
4433 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG285900.1

Sequence Viewer

Length: 231 bp
ATGAAGCATTCATCTGCAGGAAGCCGTATTGTTAGTATGAGCTCAAGATTGGGAAGACTAAATGGCAAACAAAATGAAGAGCACATTGAAATTGCCAAAGCCAAGAAAAAAGCAAGAGAAACAGAGTTGTGCTCATATGAGGAACAGCTTCATGCTACGATCAAAAGCTTGCAATATATCATACAACAAGAATGCATTCTGTTTAGAAAAACCTTAGATCAAACAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.73

Weight (kDa)

9.3

Isoelectric Point (pI)

66.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 89
AluBI AGCT 3 cut(s) 42, 148, 168
AluI AGCT 3 cut(s) 42, 148, 168
Alw21I GWGCWC 3 cut(s) 44, 84, 134
Asp700I GAANNNNTTC 2 cut(s) 147, 195
BanII GRGCYC 1 cut(s) 44
BbsI GAAGAC 1 cut(s) 61
Bbv12I GWGCWC 3 cut(s) 44, 84, 134
BceAI ACGGC 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 15
BpiI GAAGAC 1 cut(s) 61
BplI GAGNNNNNCTC 2 cut(s) 116, 148
BpuEI CTTGAG 1 cut(s) 28
BsiHKAI GWGCWC 3 cut(s) 44, 84, 134
BsmI GAATGC 3 cut(s) 7, 195, 197
Bsp1286I GDGCHC 3 cut(s) 44, 84, 134
Bsp143I GATC 2 cut(s) 159, 217
BspMAI CTGCAG 1 cut(s) 19
BspQI GCTCTTC 1 cut(s) 72
BssMI GATC 2 cut(s) 159, 217
Bst6I CTCTTC 1 cut(s) 72
BstC8I GCNNGC 1 cut(s) 170
BstDEI CTNAG 1 cut(s) 214
BstKTI GATC 2 cut(s) 162, 220
BstMBI GATC 2 cut(s) 159, 217
BstSFI CTRYAG 1 cut(s) 15
BstV2I GAAGAC 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 170
CviAII CATG 1 cut(s) 152
CviJI RGCY 5 cut(s) 24, 42, 101, 148, 168
CviKI_1 RGCY 5 cut(s) 24, 42, 101, 148, 168
DdeI CTNAG 1 cut(s) 214
DpnI GATC 2 cut(s) 161, 219
DpnII GATC 2 cut(s) 159, 217
Eam1104I CTCTTC 1 cut(s) 72
EarI CTCTTC 1 cut(s) 72
Ecl136II GAGCTC 1 cut(s) 42
Eco24I GRGCYC 1 cut(s) 44
Eco53kI GAGCTC 1 cut(s) 42
EcoICRI GAGCTC 1 cut(s) 42
EcoT22I ATGCAT 1 cut(s) 197
EcoT38I GRGCYC 1 cut(s) 44
FaeI CATG 1 cut(s) 155
FaiI YATR 6 cut(s) 38, 136, 138, 153, 177, 182
FatI CATG 1 cut(s) 151
FauNDI CATATG 1 cut(s) 136
FriOI GRGCYC 1 cut(s) 44
FspEI CC 9 cut(s) 3, 35, 36, 38, 48, 109, 115, 125, 226
Hin1II CATG 1 cut(s) 155
HindIII AAGCTT 1 cut(s) 166
Hpy188III TCNNGA 1 cut(s) 45
HpyCH4V TGCA 3 cut(s) 17, 172, 195
HpyF3I CTNAG 1 cut(s) 214
Hsp92II CATG 1 cut(s) 155
Kzo9I GATC 2 cut(s) 159, 217
LguI GCTCTTC 1 cut(s) 72
LpnPI CCDG 1 cut(s) 3
MalI GATC 2 cut(s) 161, 219
MboI GATC 2 cut(s) 159, 217
MboII GAAGA 2 cut(s) 66, 89
MhlI GDGCHC 3 cut(s) 44, 84, 134
MluCI AATT 1 cut(s) 90
MnlI CCTC 1 cut(s) 133
Mph1103I ATGCAT 1 cut(s) 197
MroXI GAANNNNTTC 2 cut(s) 147, 195
Mva1269I GAATGC 3 cut(s) 7, 195, 197
NdeI CATATG 1 cut(s) 136
NdeII GATC 2 cut(s) 159, 217
NlaIII CATG 1 cut(s) 155
NsiI ATGCAT 1 cut(s) 197
PciSI GCTCTTC 1 cut(s) 72
PctI GAATGC 3 cut(s) 7, 195, 197
PdmI GAANNNNTTC 2 cut(s) 147, 195
Psp124BI GAGCTC 1 cut(s) 44
PstI CTGCAG 1 cut(s) 19
SacI GAGCTC 1 cut(s) 44
SapI GCTCTTC 1 cut(s) 72
Sau3AI GATC 2 cut(s) 159, 217
SduI GDGCHC 3 cut(s) 44, 84, 134
SetI ASST 4 cut(s) 44, 150, 170, 215
SfcI CTRYAG 1 cut(s) 15
SgeI CNNG 7 cut(s) 30, 57, 115, 126, 164, 181, 200
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 1 cut(s) 90
SstI GAGCTC 1 cut(s) 44
TasI AATT 1 cut(s) 90
TspDTI ATGAA 3 cut(s) 17, 90, 140
XmnI GAANNNNTTC 2 cut(s) 147, 195
Zsp2I ATGCAT 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.