Rh2AG413900

Sigma factor PP2C-like phosphatases

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
61454226 .. 61454993
768 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG413900.1

Sequence Viewer

Length: 261 bp
ATGACAAGAGCAATAGGTGACCAAGATCTAAAGCCGTGGATTATTTCAGAGCCAGAAGTTACTTTTTTGACCAGAAGTGATACTGATGAATGCTTGATTCTGGTGAGTGATGGCTTATGGGATGTGATGTCTAATGAAAAGGTGATGGCGATGGCTCGCAGGATGCTGAGGGAGCTTCGCAATCAGTATGCAACGGTAGCCAATGGATCAGTCAGCCCAGCACAGTATGTTGCAGAAGAAGTCCTCAAGAATGCTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.7

Weight (kDa)

4.65

Isoelectric Point (pI)

60.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2C PF00481 1 - 76 4.5e-18 Protein phosphatase 2C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018325)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G17545
rosa_chinensis RchiOBHm_Chr2g0140491
rosa_laevigata RLG00000019871
rosa_rugosa Rorug02G0363300
rosa_samantha Rh2AG413800 Rh2AG413900 Rh2BG424000 Rh2CG400200 Rh2CG400300 Rh2DG433700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 214
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
AlwI GGATC 1 cut(s) 214
AsuHPI GGTGA 3 cut(s) 29, 115, 154
BbvCI CCTCAGC 1 cut(s) 167
BccI CCATC 3 cut(s) 104, 139, 145
BceAI ACGGC 1 cut(s) 19
BglII AGATCT 1 cut(s) 25
BmsI GCATC 1 cut(s) 153
Bpu10I CCTNAGC 1 cut(s) 167
BpuEI CTTGAG 1 cut(s) 230
BsaJI CCNNGG 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 35
BseGI GGATG 2 cut(s) 127, 168
BseMII CTCAG 1 cut(s) 158
BseYI CCCAGC 1 cut(s) 217
BsmI GAATGC 2 cut(s) 95, 256
Bsp143I GATC 2 cut(s) 25, 206
BspCNI CTCAG 1 cut(s) 159
BspPI GGATC 1 cut(s) 214
BssECI CCNNGG 1 cut(s) 35
BssMI GATC 2 cut(s) 25, 206
Bst4CI ACNGT 2 cut(s) 196, 225
BstC8I GCNNGC 1 cut(s) 157
BstDEI CTNAG 1 cut(s) 167
BstDSI CCRYGG 1 cut(s) 35
BstEII GGTNACC 1 cut(s) 17
BstF5I GGATG 2 cut(s) 127, 168
BstKTI GATC 2 cut(s) 28, 209
BstMBI GATC 2 cut(s) 25, 206
BstMWI GCNNNNNNNGC 2 cut(s) 172, 197
BstPI GGTNACC 1 cut(s) 17
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BtgI CCRYGG 1 cut(s) 35
BtgZI GCGATG 1 cut(s) 164
BtsCI GGATG 2 cut(s) 127, 168
Cac8I GCNNGC 1 cut(s) 157
CviJI RGCY 7 cut(s) 34, 52, 114, 155, 175, 200, 216
CviKI_1 RGCY 7 cut(s) 34, 52, 114, 155, 175, 200, 216
DdeI CTNAG 1 cut(s) 167
DpnI GATC 2 cut(s) 27, 208
DpnII GATC 2 cut(s) 25, 206
Eco91I GGTNACC 1 cut(s) 17
EcoO65I GGTNACC 1 cut(s) 17
FaiI YATR 3 cut(s) 118, 189, 228
FokI GGATG 2 cut(s) 134, 175
GsaI CCCAGC 1 cut(s) 221
HinfI GANTC 1 cut(s) 97
HphI GGTGA 3 cut(s) 29, 115, 154
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 247
HpyCH4III ACNGT 2 cut(s) 196, 225
HpyCH4V TGCA 2 cut(s) 191, 233
HpyF10VI GCNNNNNNNGC 2 cut(s) 172, 197
HpyF3I CTNAG 1 cut(s) 167
Kzo9I GATC 2 cut(s) 25, 206
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 5 cut(s) 66, 85, 86, 145, 231
LweI GCATC 1 cut(s) 153
MaeIII GTNAC 2 cut(s) 17, 58
MalI GATC 2 cut(s) 27, 208
MboI GATC 2 cut(s) 25, 206
MboII GAAGA 1 cut(s) 248
MflI RGATCY 1 cut(s) 25
MnlI CCTC 2 cut(s) 162, 254
Mva1269I GAATGC 2 cut(s) 95, 256
MwoI GCNNNNNNNGC 2 cut(s) 172, 197
NdeII GATC 2 cut(s) 25, 206
NmuCI GTSAC 1 cut(s) 17
PctI GAATGC 2 cut(s) 95, 256
PfeI GAWTC 1 cut(s) 97
PspEI GGTNACC 1 cut(s) 17
PspFI CCCAGC 1 cut(s) 217
PsuI RGATCY 1 cut(s) 25
Sau3AI GATC 2 cut(s) 25, 206
SetI ASST 3 cut(s) 19, 144, 177
SfaNI GCATC 1 cut(s) 153
SmlI CTYRAG 1 cut(s) 245
SmoI CTYRAG 1 cut(s) 245
TaaI ACNGT 2 cut(s) 196, 225
TfiI GAWTC 1 cut(s) 97
TseFI GTSAC 1 cut(s) 17
Tsp45I GTSAC 1 cut(s) 17
TspDTI ATGAA 2 cut(s) 102, 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.