Rh2CG400200

protein serine/threonine phosphatase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0018325
Physical Location & Seq
Forward (+)
54427082 .. 54427936
855 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG400200.1

Sequence Viewer

Length: 222 bp
ATGGGAGCCCTTGTTAGGGCTTACAACAGAGCAGATGATGCTTTTATAGACAAGACATTAGCACCAGATACAGTTGGATTGACAGCTGTGGTAGTGATTCTGTCAGCCTGTCAGATCATTGTTGCCAATTGCGGTGACTCTAGGGCTGTGCTTTGTTGTGGAAATCAAGTGATCCCATTGACTGTCGACCACAAGCCTGACAGAGACGATGGAAGTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04016 ko04075 ko04931 map04016 map04075 map04931
Pfam Domains
Protein Families
PP2C

Protein Analysis

73

Amino Acids

7.66

Weight (kDa)

4.6

Isoelectric Point (pI)

10.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2C PF00481 8 - 69 2.4e-15 Protein phosphatase 2C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018325)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G17545
rosa_chinensis RchiOBHm_Chr2g0140491
rosa_laevigata RLG00000019871
rosa_rugosa Rorug02G0363300
rosa_samantha Rh2AG413800 Rh2AG413900 Rh2BG424000 Rh2CG400200 Rh2CG400300 Rh2DG433700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 186
AciI CCGC 1 cut(s) 132
AclWI GGATC 1 cut(s) 166
AfiI CCNNNNNNNGG 2 cut(s) 15, 16
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Alw26I GTCTC 1 cut(s) 198
AlwI GGATC 1 cut(s) 166
AsuHPI GGTGA 1 cut(s) 146
BanII GRGCYC 1 cut(s) 10
BccI CCATC 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 198
BfaI CTAG 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 7
BmsI GCATC 1 cut(s) 28
BsaXI ACNNNNNCTCC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 2 cut(s) 15, 16
BseLI CCNNNNNNNGG 2 cut(s) 15, 16
BslI CCNNNNNNNGG 2 cut(s) 15, 16
BsmAI GTCTC 1 cut(s) 198
BsmBI CGTCTC 1 cut(s) 198
Bsp1286I GDGCHC 1 cut(s) 10
Bsp143I GATC 2 cut(s) 114, 171
BspACI CCGC 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 7
BspPI GGATC 1 cut(s) 166
BssMI GATC 2 cut(s) 114, 171
Bst4CI ACNGT 2 cut(s) 73, 184
BstAPI GCANNNNNTGC 1 cut(s) 38
BstKTI GATC 2 cut(s) 117, 174
BstMAI GTCTC 1 cut(s) 198
BstMBI GATC 2 cut(s) 114, 171
BstMWI GCNNNNNNNGC 1 cut(s) 38
CviJI RGCY 6 cut(s) 8, 20, 86, 107, 146, 196
CviKI_1 RGCY 6 cut(s) 8, 20, 86, 107, 146, 196
DpnI GATC 2 cut(s) 116, 173
DpnII GATC 2 cut(s) 114, 171
Eco24I GRGCYC 1 cut(s) 10
EcoT38I GRGCYC 1 cut(s) 10
Esp3I CGTCTC 1 cut(s) 198
FaiI YATR 1 cut(s) 47
FblI GTMKAC 1 cut(s) 186
FriOI GRGCYC 1 cut(s) 10
FspBI CTAG 1 cut(s) 141
HincII GTYRAC 1 cut(s) 187
HindII GTYRAC 1 cut(s) 187
HinfI GANTC 2 cut(s) 97, 137
HphI GGTGA 1 cut(s) 146
Hpy166II GTNNAC 1 cut(s) 187
Hpy188I TCNGA 1 cut(s) 114
Hpy8I GTNNAC 1 cut(s) 187
HpyCH4III ACNGT 2 cut(s) 73, 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
Kzo9I GATC 2 cut(s) 114, 171
LmnI GCTCC 1 cut(s) 5
LpnPI CCDG 3 cut(s) 78, 121, 210
LweI GCATC 1 cut(s) 28
MaeI CTAG 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 134
MalI GATC 2 cut(s) 116, 173
MboI GATC 2 cut(s) 114, 171
MfeI CAATTG 1 cut(s) 127
MhlI GDGCHC 1 cut(s) 10
MluCI AATT 2 cut(s) 127, 217
MlyI GAGTC 1 cut(s) 131
MmeI TCCRAC 1 cut(s) 55
MspA1I CMGCKG 1 cut(s) 86
MunI CAATTG 1 cut(s) 127
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 2 cut(s) 114, 171
NlaIV GGNNCC 1 cut(s) 7
NmuCI GTSAC 1 cut(s) 134
PfeI GAWTC 1 cut(s) 97
PleI GAGTC 1 cut(s) 131
PpsI GAGTC 1 cut(s) 131
PspN4I GGNNCC 1 cut(s) 7
PvuII CAGCTG 1 cut(s) 86
SalI GTCGAC 1 cut(s) 185
Sau3AI GATC 2 cut(s) 114, 171
SchI GAGTC 1 cut(s) 131
SduI GDGCHC 1 cut(s) 10
SetI ASST 1 cut(s) 88
SfaNI GCATC 1 cut(s) 28
SgeI CNNG 8 cut(s) 23, 64, 77, 120, 153, 179, 205, 209
Sse9I AATT 2 cut(s) 127, 217
SsiI CCGC 1 cut(s) 132
SspMI CTAG 1 cut(s) 141
TaaI ACNGT 2 cut(s) 73, 184
TaqI TCGA 1 cut(s) 186
TasI AATT 2 cut(s) 127, 217
TfiI GAWTC 1 cut(s) 97
TseFI GTSAC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 134
XmiI GTMKAC 1 cut(s) 186
XspI CTAG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.