Rh2AG539500

Promotes mitochondrial protein synthesis. May act as a fidelity factor of the translation reaction, by catalyzing a one- codon backward translocation of tRNAs on improperly translocated ribosomes. Binds to mitochondrial ribosomes in a GTP-dependent manner

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0018831
Physical Location & Seq
Reverse (-)
76741078 .. 76745624
4547 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG539500.1

Sequence Viewer

Length: 219 bp
ATGGAAGCTGTTCTGGGTTTCCAGCGCCAAAACAACAAAGAAAACGTCGTGGATTTGAGCCAGTACCCTACTAAGAGGATCAGGAACTTCTCCATTATTGCCCATGTCGATCACGGCAAGTCTACTCTGGCTGATAGGCTCTTGGAGCTCACTGTGACCATTAAGAGAGGCCATGGTCAACCTCAGTACCTTGATAAATTGCAGTACATTTATGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EFG_C GTP_EFTU GTP_EFTU_D2 LepA_C

Protein Analysis

72

Amino Acids

8.37

Weight (kDa)

9.45

Isoelectric Point (pI)

18.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GTP_EFTU PF00009 25 - 61 8.9e-11 Elongation factor Tu GTP binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018831)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g12911
pyrus_communis pycom111g03920
rosa_laevigata RLG00000020534 RLG00000023537 RLG00000028425 RLG00000035877
rosa_samantha Rh2AG244200 Rh2AG539500 Rh2DG253000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 122
AclWI GGATC 1 cut(s) 86
AfaI GTAC 3 cut(s) 65, 188, 206
AluBI AGCT 2 cut(s) 8, 148
AluI AGCT 2 cut(s) 8, 148
Alw21I GWGCWC 1 cut(s) 150
AlwI GGATC 1 cut(s) 86
AoxI GGCC 1 cut(s) 169
ArsI GACNNNNNNTTYG 2 cut(s) 30, 62
Asp700I GAANNNNTTC 1 cut(s) 9
AspLEI GCGC 1 cut(s) 27
BaeI ACNNNNGTAYC 2 cut(s) 170, 203
BanII GRGCYC 1 cut(s) 150
Bbv12I GWGCWC 1 cut(s) 150
BceAI ACGGC 1 cut(s) 130
BfaI CTAG 1 cut(s) 217
BfoI RGCGCY 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 172
Bse1I ACTGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 172
BseMII CTCAG 1 cut(s) 197
BseNI ACTGG 1 cut(s) 61
BshFI GGCC 1 cut(s) 171
BsiHKAI GWGCWC 1 cut(s) 150
BsnI GGCC 1 cut(s) 171
Bsp1286I GDGCHC 1 cut(s) 150
Bsp143I GATC 2 cut(s) 78, 109
Bsp19I CCATGG 1 cut(s) 172
BspANI GGCC 1 cut(s) 171
BspCNI CTCAG 1 cut(s) 196
BspPI GGATC 1 cut(s) 86
BsrI ACTGG 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 2 cut(s) 78, 109
BssT1I CCWWGG 1 cut(s) 172
Bst4CI ACNGT 1 cut(s) 154
BstDEI CTNAG 2 cut(s) 72, 183
BstDSI CCRYGG 1 cut(s) 172
BstH2I RGCGCY 1 cut(s) 28
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 2 cut(s) 81, 112
BstMBI GATC 2 cut(s) 78, 109
BstMWI GCNNNNNNNGC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 171
BtgI CCRYGG 1 cut(s) 172
BtsIMutI CAGTG 1 cut(s) 150
CfoI GCGC 1 cut(s) 27
Csp6I GTAC 3 cut(s) 64, 187, 205
CviAII CATG 2 cut(s) 104, 173
CviJI RGCY 6 cut(s) 8, 60, 131, 139, 148, 171
CviKI_1 RGCY 6 cut(s) 8, 60, 131, 139, 148, 171
CviQI GTAC 3 cut(s) 64, 187, 205
DdeI CTNAG 2 cut(s) 72, 183
DpnI GATC 2 cut(s) 80, 111
DpnII GATC 2 cut(s) 78, 109
Ecl136II GAGCTC 1 cut(s) 148
Eco130I CCWWGG 1 cut(s) 172
Eco24I GRGCYC 1 cut(s) 150
Eco53kI GAGCTC 1 cut(s) 148
EcoICRI GAGCTC 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 172
EcoT38I GRGCYC 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 2 cut(s) 107, 176
FaiI YATR 3 cut(s) 105, 174, 213
FatI CATG 2 cut(s) 103, 172
FblI GTMKAC 1 cut(s) 122
FriOI GRGCYC 1 cut(s) 150
FspBI CTAG 1 cut(s) 217
GlaI GCGC 1 cut(s) 26
HaeII RGCGCY 1 cut(s) 28
HaeIII GGCC 1 cut(s) 171
HhaI GCGC 1 cut(s) 27
Hin1II CATG 2 cut(s) 107, 176
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HincII GTYRAC 1 cut(s) 179
HindII GTYRAC 1 cut(s) 179
Hpy166II GTNNAC 2 cut(s) 123, 179
Hpy188III TCNNGA 1 cut(s) 82
Hpy8I GTNNAC 2 cut(s) 123, 179
Hpy99I CGWCG 1 cut(s) 50
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4IV ACGT 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
HpyF3I CTNAG 2 cut(s) 72, 183
HpySE526I ACGT 1 cut(s) 45
Hsp92II CATG 2 cut(s) 107, 176
HspAI GCGC 1 cut(s) 25
Kzo9I GATC 2 cut(s) 78, 109
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 35, 67, 74, 113
MaeI CTAG 1 cut(s) 217
MaeII ACGT 1 cut(s) 45
MaeIII GTNAC 1 cut(s) 154
MalI GATC 2 cut(s) 80, 111
MboI GATC 2 cut(s) 78, 109
MhlI GDGCHC 1 cut(s) 150
MluCI AATT 1 cut(s) 197
MnlI CCTC 3 cut(s) 69, 161, 192
MroXI GAANNNNTTC 1 cut(s) 9
MseI TTAA 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 145
NcoI CCATGG 1 cut(s) 172
NdeII GATC 2 cut(s) 78, 109
NlaIII CATG 2 cut(s) 107, 176
NmuCI GTSAC 1 cut(s) 154
PdmI GAANNNNTTC 1 cut(s) 9
Psp124BI GAGCTC 1 cut(s) 150
RsaI GTAC 3 cut(s) 65, 188, 206
RsaNI GTAC 3 cut(s) 64, 187, 205
SacI GAGCTC 1 cut(s) 150
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 2 cut(s) 78, 109
SduI GDGCHC 1 cut(s) 150
SetI ASST 5 cut(s) 10, 48, 150, 184, 192
Sse9I AATT 1 cut(s) 197
SspMI CTAG 1 cut(s) 217
SstI GAGCTC 1 cut(s) 150
StyI CCWWGG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 154
TaiI ACGT 1 cut(s) 48
TaqI TCGA 1 cut(s) 108
TasI AATT 1 cut(s) 197
TatI WGTACW 1 cut(s) 204
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TscAI CASTG 1 cut(s) 157
TseFI GTSAC 1 cut(s) 154
Tsp45I GTSAC 1 cut(s) 154
TspRI CASTG 1 cut(s) 157
XmiI GTMKAC 1 cut(s) 122
XmnI GAANNNNTTC 1 cut(s) 9
XspI CTAG 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.