Rh2BG191000

NHL repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
17180727 .. 17183968
3242 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG191000.1

Sequence Viewer

Length: 411 bp
ATGAGGGAGATGAGTTGGTTGAAATTAACGGTAGTCAATGATGGAGATATGTATCTATGGAGAGAGCTAGGTGTGAATTCATGGCTAACATTTGCTGTTGTTGGGCCCAATGGAAGACTTCTTGCTCAACATTTGGAGAAAGATAATGATCCCCGTTTGTTTATATCTCCATTAAAGTTTCCTGGAAAGCTAGCAGTTGATGTCGAAAACAATAGGCTCTTCATTTCAGACAGTAATCATATCCGCATACTACTCAACTCTCCATGGGATGTCTGCTTTCATCCAGTCAATGAGAAAGTTTATATTGCCATGGCTGGCCAACATCAAATTTGGCAACTTGATACAGCTGATGGGATTACTAGAGCATTTAGTGGTGATGGTTATGAAAGAAATCTGAATGGATCAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

15.58

Weight (kDa)

6.05

Isoelectric Point (pI)

24.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 244
AclWI GGATC 2 cut(s) 143, 409
AcoI YGGCCR 1 cut(s) 316
AcsI RAATTY 2 cut(s) 76, 327
AgsI TTSAA 1 cut(s) 22
AjnI CCWGG 1 cut(s) 181
AluBI AGCT 3 cut(s) 67, 190, 347
AluI AGCT 3 cut(s) 67, 190, 347
AlwI GGATC 2 cut(s) 143, 409
AoxI GGCC 2 cut(s) 104, 316
ApaI GGGCCC 1 cut(s) 108
ApoI RAATTY 2 cut(s) 76, 327
AspS9I GGNCC 2 cut(s) 104, 105
AsuHPI GGTGA 1 cut(s) 386
AsuNHI GCTAGC 1 cut(s) 190
BaeGI GKGCMC 1 cut(s) 108
BalI TGGCCA 1 cut(s) 318
BanII GRGCYC 1 cut(s) 108
BbsI GAAGAC 1 cut(s) 121
BccI CCATC 3 cut(s) 35, 344, 371
BciT130I CCWGG 1 cut(s) 183
BfaI CTAG 3 cut(s) 68, 191, 360
Bme1390I CCNGG 1 cut(s) 183
BmgT120I GGNCC 2 cut(s) 104, 105
BmiI GGNNCC 1 cut(s) 106
BmrFI CCNGG 1 cut(s) 183
BmtI GCTAGC 1 cut(s) 194
BpiI GAAGAC 1 cut(s) 121
BsaBI GATNNNNATC 2 cut(s) 51, 147
BsaJI CCNNGG 2 cut(s) 263, 309
Bse1I ACTGG 1 cut(s) 284
Bse8I GATNNNNATC 2 cut(s) 51, 147
BseBI CCWGG 1 cut(s) 183
BseDI CCNNGG 2 cut(s) 263, 309
BseGI GGATG 2 cut(s) 274, 280
BseJI GATNNNNATC 2 cut(s) 51, 147
BseNI ACTGG 1 cut(s) 284
BseSI GKGCMC 1 cut(s) 108
BshFI GGCC 2 cut(s) 106, 318
BsnI GGCC 2 cut(s) 106, 318
Bsp120I GGGCCC 1 cut(s) 104
Bsp1286I GDGCHC 1 cut(s) 108
Bsp143I GATC 2 cut(s) 148, 401
Bsp19I CCATGG 2 cut(s) 263, 309
BspACI CCGC 1 cut(s) 244
BspANI GGCC 2 cut(s) 106, 318
BspLI GGNNCC 1 cut(s) 106
BspOI GCTAGC 1 cut(s) 194
BspPI GGATC 2 cut(s) 143, 409
BspQI GCTCTTC 1 cut(s) 224
BsrI ACTGG 1 cut(s) 284
BssECI CCNNGG 2 cut(s) 263, 309
BssMI GATC 2 cut(s) 148, 401
BssT1I CCWWGG 2 cut(s) 263, 309
Bst2UI CCWGG 1 cut(s) 183
Bst4CI ACNGT 2 cut(s) 31, 233
Bst6I CTCTTC 1 cut(s) 224
BstC8I GCNNGC 2 cut(s) 192, 316
BstDSI CCRYGG 2 cut(s) 263, 309
BstF5I GGATG 2 cut(s) 274, 280
BstKTI GATC 2 cut(s) 151, 404
BstMBI GATC 2 cut(s) 148, 401
BstNI CCWGG 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 181
BstSLI GKGCMC 1 cut(s) 108
BstV2I GAAGAC 1 cut(s) 121
BsuRI GGCC 2 cut(s) 106, 318
BtgI CCRYGG 2 cut(s) 263, 309
BtsCI GGATG 2 cut(s) 274, 280
Cac8I GCNNGC 2 cut(s) 192, 316
Cfr13I GGNCC 2 cut(s) 104, 105
CviAII CATG 3 cut(s) 81, 264, 310
CviJI RGCY 8 cut(s) 67, 85, 106, 190, 217, 314, 318, 347
CviKI_1 RGCY 8 cut(s) 67, 85, 106, 190, 217, 314, 318, 347
DpnI GATC 2 cut(s) 150, 403
DpnII GATC 2 cut(s) 148, 401
EaeI YGGCCR 1 cut(s) 316
Eam1104I CTCTTC 1 cut(s) 224
EarI CTCTTC 1 cut(s) 224
Eco130I CCWWGG 2 cut(s) 263, 309
Eco24I GRGCYC 1 cut(s) 108
EcoRI GAATTC 1 cut(s) 76
EcoRII CCWGG 1 cut(s) 181
EcoT14I CCWWGG 2 cut(s) 263, 309
EcoT38I GRGCYC 1 cut(s) 108
ErhI CCWWGG 2 cut(s) 263, 309
FaeI CATG 3 cut(s) 84, 267, 313
FatI CATG 3 cut(s) 80, 263, 309
FokI GGATG 2 cut(s) 267, 281
FriOI GRGCYC 1 cut(s) 108
FspBI CTAG 3 cut(s) 68, 191, 360
HaeIII GGCC 2 cut(s) 106, 318
Hin1II CATG 3 cut(s) 84, 267, 313
HphI GGTGA 1 cut(s) 386
Hpy188I TCNGA 2 cut(s) 229, 396
HpyCH4III ACNGT 2 cut(s) 31, 233
Hsp92II CATG 3 cut(s) 84, 267, 313
Kzo9I GATC 2 cut(s) 148, 401
LguI GCTCTTC 1 cut(s) 224
LpnPI CCDG 4 cut(s) 168, 195, 297, 300
MaeI CTAG 3 cut(s) 68, 191, 360
MalI GATC 2 cut(s) 150, 403
MboI GATC 2 cut(s) 148, 401
MboII GAAGA 2 cut(s) 126, 211
MhlI GDGCHC 1 cut(s) 108
MlsI TGGCCA 1 cut(s) 318
MluCI AATT 3 cut(s) 23, 76, 327
MluNI TGGCCA 1 cut(s) 318
Mox20I TGGCCA 1 cut(s) 318
MscI TGGCCA 1 cut(s) 318
MseI TTAA 2 cut(s) 26, 173
Msp20I TGGCCA 1 cut(s) 318
MspA1I CMGCKG 1 cut(s) 347
MspR9I CCNGG 1 cut(s) 183
MvaI CCWGG 1 cut(s) 183
NcoI CCATGG 2 cut(s) 263, 309
NdeII GATC 2 cut(s) 148, 401
NheI GCTAGC 1 cut(s) 190
NlaIII CATG 3 cut(s) 84, 267, 313
NlaIV GGNNCC 1 cut(s) 106
PciSI GCTCTTC 1 cut(s) 224
PfoI TCCNGGA 1 cut(s) 181
Psp6I CCWGG 1 cut(s) 181
PspGI CCWGG 1 cut(s) 181
PspN4I GGNNCC 1 cut(s) 106
PspOMI GGGCCC 1 cut(s) 104
PspPI GGNCC 2 cut(s) 104, 105
PvuII CAGCTG 1 cut(s) 347
SapI GCTCTTC 1 cut(s) 224
SaqAI TTAA 2 cut(s) 26, 173
Sau3AI GATC 2 cut(s) 148, 401
Sau96I GGNCC 2 cut(s) 104, 105
ScrFI CCNGG 1 cut(s) 183
SduI GDGCHC 1 cut(s) 108
SetI ASST 5 cut(s) 69, 73, 192, 349, 410
Sse9I AATT 3 cut(s) 23, 76, 327
SsiI CCGC 1 cut(s) 244
SspMI CTAG 3 cut(s) 68, 191, 360
StyD4I CCNGG 1 cut(s) 181
StyI CCWWGG 2 cut(s) 263, 309
TaaI ACNGT 2 cut(s) 31, 233
TaqI TCGA 1 cut(s) 204
TasI AATT 3 cut(s) 23, 76, 327
Tru1I TTAA 2 cut(s) 26, 173
Tru9I TTAA 2 cut(s) 26, 173
TspDTI ATGAA 4 cut(s) 69, 211, 269, 399
XapI RAATTY 2 cut(s) 76, 327
XspI CTAG 3 cut(s) 68, 191, 360
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.