Rh6CG219600

NHL repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
36524663 .. 36546571
21909 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG219600.1

Sequence Viewer

Length: 255 bp
ATGCTGAGATTCCCTTTCAACTGGTTTCATCCATGTCTGTTCTTGCTCCCAGCTTTTGGTTTCTCCTCCTTGAAATCTGGTTATATTATTCAGCTACTCAACTCTCCATGGGATGTCTGCTTTCATCCAGTCAATGAGAAAGTTTATATTGCCATGGCTGGCCAACATCAAATTTGGCAACTTGATACAGCTGATGGGATTACTAGAGCATTTAGTGGTGATGGTTATGAAAGAAATCTGAATGGATCAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.65

Weight (kDa)

6.81

Isoelectric Point (pI)

24.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 56
AclWI GGATC 1 cut(s) 253
AcoI YGGCCR 1 cut(s) 160
AcsI RAATTY 1 cut(s) 171
AfiI CCNNNNNNNGG 1 cut(s) 56
AgsI TTSAA 2 cut(s) 19, 73
AluBI AGCT 3 cut(s) 53, 94, 191
AluI AGCT 3 cut(s) 53, 94, 191
AlwI GGATC 1 cut(s) 253
AoxI GGCC 1 cut(s) 160
ApoI RAATTY 1 cut(s) 171
AsuHPI GGTGA 1 cut(s) 230
BalI TGGCCA 1 cut(s) 162
BccI CCATC 2 cut(s) 188, 215
BfaI CTAG 1 cut(s) 204
BsaJI CCNNGG 2 cut(s) 107, 153
Bsc4I CCNNNNNNNGG 1 cut(s) 56
Bse1I ACTGG 2 cut(s) 26, 128
BseDI CCNNGG 2 cut(s) 107, 153
BseGI GGATG 3 cut(s) 28, 118, 124
BseLI CCNNNNNNNGG 1 cut(s) 56
BseNI ACTGG 2 cut(s) 26, 128
BseRI GAGGAG 1 cut(s) 55
BseYI CCCAGC 1 cut(s) 49
BshFI GGCC 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 56
BsnI GGCC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 245
Bsp19I CCATGG 2 cut(s) 107, 153
BspANI GGCC 1 cut(s) 162
BspPI GGATC 1 cut(s) 253
BsrI ACTGG 2 cut(s) 26, 128
BssECI CCNNGG 2 cut(s) 107, 153
BssMI GATC 1 cut(s) 245
BssT1I CCWWGG 2 cut(s) 107, 153
BstC8I GCNNGC 1 cut(s) 160
BstDEI CTNAG 1 cut(s) 5
BstDSI CCRYGG 2 cut(s) 107, 153
BstF5I GGATG 3 cut(s) 28, 118, 124
BstKTI GATC 1 cut(s) 248
BstMBI GATC 1 cut(s) 245
BsuRI GGCC 1 cut(s) 162
BtgI CCRYGG 2 cut(s) 107, 153
BtsCI GGATG 3 cut(s) 28, 118, 124
Cac8I GCNNGC 1 cut(s) 160
CviAII CATG 3 cut(s) 33, 108, 154
CviJI RGCY 5 cut(s) 53, 94, 158, 162, 191
CviKI_1 RGCY 5 cut(s) 53, 94, 158, 162, 191
DdeI CTNAG 1 cut(s) 5
DpnI GATC 1 cut(s) 247
DpnII GATC 1 cut(s) 245
EaeI YGGCCR 1 cut(s) 160
Eco130I CCWWGG 2 cut(s) 107, 153
EcoT14I CCWWGG 2 cut(s) 107, 153
ErhI CCWWGG 2 cut(s) 107, 153
FaeI CATG 3 cut(s) 36, 111, 157
FaiI YATR 6 cut(s) 34, 84, 109, 147, 155, 228
FatI CATG 3 cut(s) 32, 107, 153
FokI GGATG 3 cut(s) 15, 111, 125
FspBI CTAG 1 cut(s) 204
GsaI CCCAGC 1 cut(s) 53
HaeIII GGCC 1 cut(s) 162
Hin1II CATG 3 cut(s) 36, 111, 157
HinfI GANTC 1 cut(s) 9
HphI GGTGA 1 cut(s) 230
Hpy188I TCNGA 1 cut(s) 240
HpyF3I CTNAG 1 cut(s) 5
Hsp92II CATG 3 cut(s) 36, 111, 157
Kzo9I GATC 1 cut(s) 245
LmnI GCTCC 1 cut(s) 51
LpnPI CCDG 5 cut(s) 7, 63, 63, 141, 144
MaeI CTAG 1 cut(s) 204
MalI GATC 1 cut(s) 247
MboI GATC 1 cut(s) 245
MlsI TGGCCA 1 cut(s) 162
MluCI AATT 1 cut(s) 171
MluNI TGGCCA 1 cut(s) 162
MnlI CCTC 1 cut(s) 76
Mox20I TGGCCA 1 cut(s) 162
MscI TGGCCA 1 cut(s) 162
Msp20I TGGCCA 1 cut(s) 162
MspA1I CMGCKG 1 cut(s) 191
NcoI CCATGG 2 cut(s) 107, 153
NdeII GATC 1 cut(s) 245
NlaIII CATG 3 cut(s) 36, 111, 157
PfeI GAWTC 1 cut(s) 9
PflMI CCANNNNNTGG 1 cut(s) 56
PspFI CCCAGC 1 cut(s) 49
PvuII CAGCTG 1 cut(s) 191
Sau3AI GATC 1 cut(s) 245
SetI ASST 4 cut(s) 55, 96, 193, 254
Sse9I AATT 1 cut(s) 171
SspMI CTAG 1 cut(s) 204
StyI CCWWGG 2 cut(s) 107, 153
TasI AATT 1 cut(s) 171
TfiI GAWTC 1 cut(s) 9
TspDTI ATGAA 3 cut(s) 17, 113, 243
Van91I CCANNNNNTGG 1 cut(s) 56
XapI RAATTY 1 cut(s) 171
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.