Rh5AG337400

NHL repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
54415324 .. 54417154
1831 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG337400.1

Sequence Viewer

Length: 210 bp
ATGTCGGGCCACTTTCATCCAATTCCACCTATGGTCTCCATGGAACTGCTACTCAACTCTCCATGGGATGTCTGCTTTCATCCAGTCAATGAGAAAGTTTATATTGCCATGGCTGGCCAACATCAAATTTGGCAACTTGATACAGCTGATGGGATTACTAGAGCATTTAGTGGTGATGGTTATGAAAGAAATCTGAATGGATCAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.78

Weight (kDa)

5.64

Isoelectric Point (pI)

18.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 208
AcoI YGGCCR 1 cut(s) 115
AcsI RAATTY 1 cut(s) 126
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw26I GTCTC 1 cut(s) 40
AlwI GGATC 1 cut(s) 208
AoxI GGCC 2 cut(s) 7, 115
ApoI RAATTY 1 cut(s) 126
AspS9I GGNCC 1 cut(s) 7
AsuHPI GGTGA 1 cut(s) 185
BalI TGGCCA 1 cut(s) 117
BccI CCATC 2 cut(s) 143, 170
BcoDI GTCTC 1 cut(s) 40
BfaI CTAG 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 7
BsaI GGTCTC 1 cut(s) 40
BsaJI CCNNGG 3 cut(s) 39, 62, 108
Bse1I ACTGG 1 cut(s) 83
BseDI CCNNGG 3 cut(s) 39, 62, 108
BseGI GGATG 3 cut(s) 16, 73, 79
BseNI ACTGG 1 cut(s) 83
BshFI GGCC 2 cut(s) 9, 117
BsmAI GTCTC 1 cut(s) 40
BsnI GGCC 2 cut(s) 9, 117
Bso31I GGTCTC 1 cut(s) 40
Bsp143I GATC 1 cut(s) 200
Bsp19I CCATGG 3 cut(s) 39, 62, 108
BspANI GGCC 2 cut(s) 9, 117
BspPI GGATC 1 cut(s) 208
BspTNI GGTCTC 1 cut(s) 40
BsrI ACTGG 1 cut(s) 83
BssECI CCNNGG 3 cut(s) 39, 62, 108
BssMI GATC 1 cut(s) 200
BssT1I CCWWGG 3 cut(s) 39, 62, 108
BstC8I GCNNGC 1 cut(s) 115
BstDSI CCRYGG 3 cut(s) 39, 62, 108
BstF5I GGATG 3 cut(s) 16, 73, 79
BstKTI GATC 1 cut(s) 203
BstMAI GTCTC 1 cut(s) 40
BstMBI GATC 1 cut(s) 200
BsuRI GGCC 2 cut(s) 9, 117
BtgI CCRYGG 3 cut(s) 39, 62, 108
BtsCI GGATG 3 cut(s) 16, 73, 79
Cac8I GCNNGC 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 7
CviAII CATG 3 cut(s) 40, 63, 109
CviJI RGCY 4 cut(s) 9, 113, 117, 146
CviKI_1 RGCY 4 cut(s) 9, 113, 117, 146
DpnI GATC 1 cut(s) 202
DpnII GATC 1 cut(s) 200
EaeI YGGCCR 1 cut(s) 115
Eco130I CCWWGG 3 cut(s) 39, 62, 108
Eco31I GGTCTC 1 cut(s) 40
EcoT14I CCWWGG 3 cut(s) 39, 62, 108
ErhI CCWWGG 3 cut(s) 39, 62, 108
FaeI CATG 3 cut(s) 43, 66, 112
FaiI YATR 6 cut(s) 32, 41, 64, 102, 110, 183
FatI CATG 3 cut(s) 39, 62, 108
FokI GGATG 3 cut(s) 3, 66, 80
FspBI CTAG 1 cut(s) 159
HaeIII GGCC 2 cut(s) 9, 117
Hin1II CATG 3 cut(s) 43, 66, 112
HphI GGTGA 1 cut(s) 185
Hpy188I TCNGA 1 cut(s) 195
Hsp92II CATG 3 cut(s) 43, 66, 112
Kzo9I GATC 1 cut(s) 200
LpnPI CCDG 2 cut(s) 96, 99
MaeI CTAG 1 cut(s) 159
MalI GATC 1 cut(s) 202
MboI GATC 1 cut(s) 200
MlsI TGGCCA 1 cut(s) 117
MluCI AATT 2 cut(s) 21, 126
MluNI TGGCCA 1 cut(s) 117
Mox20I TGGCCA 1 cut(s) 117
MscI TGGCCA 1 cut(s) 117
Msp20I TGGCCA 1 cut(s) 117
MspA1I CMGCKG 1 cut(s) 146
NcoI CCATGG 3 cut(s) 39, 62, 108
NdeII GATC 1 cut(s) 200
NlaIII CATG 3 cut(s) 43, 66, 112
PspPI GGNCC 1 cut(s) 7
PvuII CAGCTG 1 cut(s) 146
Sau3AI GATC 1 cut(s) 200
Sau96I GGNCC 1 cut(s) 7
SetI ASST 3 cut(s) 31, 148, 209
SgeI CNNG 8 cut(s) 18, 52, 75, 95, 121, 126, 149, 171
Sse9I AATT 2 cut(s) 21, 126
SspMI CTAG 1 cut(s) 159
StyI CCWWGG 3 cut(s) 39, 62, 108
TasI AATT 2 cut(s) 21, 126
TspDTI ATGAA 3 cut(s) 5, 68, 198
XapI RAATTY 1 cut(s) 126
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.