Rh7AG443700

NHL repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
60258980 .. 60260989
2010 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG443700.1

Sequence Viewer

Length: 249 bp
ATGGCTGGCCAACATCAAATTTGGCAACTTGATACAGCTGATGGGATTACTAGAGCATTTAGTGGTGATGGTTATGAAAGAAATCTGAATGGATCAAGCTCTTCAAGCATATCATTTGCACAGCCTTCTGGAATTTTATTATCTCCTGACATAAAGGCATATCTCAATGCAATTCTTCTCATATACCTGTGTACTCACGAGGTCATGAAGCAAGCAGAAAATACTACAATGATTGCTCCGAGTAGGTAA

Protein Analysis

82

Amino Acids

8.92

Weight (kDa)

5.43

Isoelectric Point (pI)

39.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 100
AcoI YGGCCR 1 cut(s) 7
AcsI RAATTY 2 cut(s) 18, 132
AfaI GTAC 1 cut(s) 193
AgsI TTSAA 1 cut(s) 105
AluBI AGCT 2 cut(s) 38, 99
AluI AGCT 2 cut(s) 38, 99
AlwI GGATC 1 cut(s) 100
AoxI GGCC 1 cut(s) 7
ApoI RAATTY 2 cut(s) 18, 132
AsuHPI GGTGA 1 cut(s) 77
BalI TGGCCA 1 cut(s) 9
BauI CACGAG 1 cut(s) 197
BccI CCATC 2 cut(s) 35, 62
BfaI CTAG 1 cut(s) 51
BshFI GGCC 1 cut(s) 9
BsnI GGCC 1 cut(s) 9
Bsp143I GATC 1 cut(s) 92
BspANI GGCC 1 cut(s) 9
BspHI TCATGA 1 cut(s) 204
BspPI GGATC 1 cut(s) 100
BspQI GCTCTTC 1 cut(s) 106
BssMI GATC 1 cut(s) 92
BssSI CACGAG 1 cut(s) 197
Bst2BI CACGAG 1 cut(s) 197
Bst6I CTCTTC 1 cut(s) 106
BstC8I GCNNGC 2 cut(s) 7, 213
BstKTI GATC 1 cut(s) 95
BstMBI GATC 1 cut(s) 92
BstMWI GCNNNNNNNGC 1 cut(s) 105
BsuRI GGCC 1 cut(s) 9
Cac8I GCNNGC 2 cut(s) 7, 213
CciI TCATGA 1 cut(s) 204
Csp6I GTAC 1 cut(s) 192
CviAII CATG 1 cut(s) 205
CviJI RGCY 5 cut(s) 5, 9, 38, 99, 124
CviKI_1 RGCY 5 cut(s) 5, 9, 38, 99, 124
CviQI GTAC 1 cut(s) 192
DpnI GATC 1 cut(s) 94
DpnII GATC 1 cut(s) 92
EaeI YGGCCR 1 cut(s) 7
Eam1104I CTCTTC 1 cut(s) 106
EarI CTCTTC 1 cut(s) 106
FaeI CATG 1 cut(s) 208
FaiI YATR 7 cut(s) 75, 110, 152, 160, 182, 184, 206
FatI CATG 1 cut(s) 204
FspBI CTAG 1 cut(s) 51
HaeIII GGCC 1 cut(s) 9
Hin1II CATG 1 cut(s) 208
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 2 cut(s) 87, 240
Hpy188III TCNNGA 4 cut(s) 129, 146, 197, 205
Hpy8I GTNNAC 1 cut(s) 192
HpyAV CCTTC 1 cut(s) 135
HpyCH4V TGCA 2 cut(s) 119, 170
HpyF10VI GCNNNNNNNGC 1 cut(s) 105
Hsp92II CATG 1 cut(s) 208
Kzo9I GATC 1 cut(s) 92
LguI GCTCTTC 1 cut(s) 106
LmnI GCTCC 1 cut(s) 241
LpnPI CCDG 3 cut(s) 114, 159, 200
MaeI CTAG 1 cut(s) 51
MalI GATC 1 cut(s) 94
MboI GATC 1 cut(s) 92
MboII GAAGA 2 cut(s) 93, 167
MlsI TGGCCA 1 cut(s) 9
MluCI AATT 3 cut(s) 18, 132, 171
MluNI TGGCCA 1 cut(s) 9
MnlI CCTC 1 cut(s) 193
Mox20I TGGCCA 1 cut(s) 9
MscI TGGCCA 1 cut(s) 9
Msp20I TGGCCA 1 cut(s) 9
MspA1I CMGCKG 1 cut(s) 38
MwoI GCNNNNNNNGC 1 cut(s) 105
NdeII GATC 1 cut(s) 92
NlaIII CATG 1 cut(s) 208
PagI TCATGA 1 cut(s) 204
PciSI GCTCTTC 1 cut(s) 106
PvuII CAGCTG 1 cut(s) 38
RsaI GTAC 1 cut(s) 193
RsaNI GTAC 1 cut(s) 192
SapI GCTCTTC 1 cut(s) 106
Sau3AI GATC 1 cut(s) 92
SetI ASST 5 cut(s) 40, 101, 189, 204, 248
Sse9I AATT 3 cut(s) 18, 132, 171
SspMI CTAG 1 cut(s) 51
TasI AATT 3 cut(s) 18, 132, 171
TatI WGTACW 1 cut(s) 191
TspDTI ATGAA 2 cut(s) 90, 221
XapI RAATTY 2 cut(s) 18, 132
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.