Rh2BG374500
ERF Family

Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
52823505 .. 52825871
2367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG374500.1

Sequence Viewer

Length: 318 bp
ATGTTCCCTTTTGAATCTCTTGCTTCTCTACCTCTTTCTCTTTCTCCCTCGTTTCTGATCATAATGAAGGAAATCGTGGGAAACCCTCTTCATCTAAAATGTCTGAATCACATCTTACTTATCTGCAGATCAGTTGAAGAATCCATTGATTTTTACCAAAATGTTCTTGGGTTTGTTTCAATCAGAAAGCCTGGATTATTTGATTTTGATGGGGCATCGTTATTCGGGTATGGAAAAGGAATTGGAATCCATCTTTTGCAATCTGAGAGCTGGAAAATATGCCCAAGAAAGTTGAAATTAAAACCGAAGGGGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.78

Weight (kDa)

9.3

Isoelectric Point (pI)

43.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012767)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G15380 AT1G15380 AT1G80160 AT1G80160
fragaria_vesca FvH4_6g30160
malus_domestica MD17G1207700.v1.1
prunus_persica Prupe.3G082100_v2.0.a1
pyrus_communis pycom17g21020
rosa_chinensis RchiOBHm_Chr3g0458691
rosa_laevigata RLG00000019525
rosa_multiflora Rmu_sc0001998.1_g000022
rosa_roxburghii Rroxscaffold_2G00108340
rosa_rugosa Rorug02G0329400
rosa_samantha Rh2AG380900 Rh2BG374500 Rh2BG387700 Rh2DG404000
rosa_wichuraiana Rw2G031150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 14, 137, 180, 295
AjnI CCWGG 1 cut(s) 190
AluBI AGCT 1 cut(s) 270
AluI AGCT 1 cut(s) 270
BccI CCATC 2 cut(s) 203, 258
BciT130I CCWGG 1 cut(s) 192
BclI TGATCA 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 124
Bme1390I CCNGG 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 192
BmsI GCATC 1 cut(s) 224
BseBI CCWGG 1 cut(s) 192
BseMII CTCAG 1 cut(s) 255
Bsp143I GATC 2 cut(s) 57, 128
BspCNI CTCAG 1 cut(s) 256
BspMAI CTGCAG 1 cut(s) 128
BssMI GATC 2 cut(s) 57, 128
Bst2UI CCWGG 1 cut(s) 192
Bst6I CTCTTC 1 cut(s) 93
BstDEI CTNAG 1 cut(s) 264
BstKTI GATC 2 cut(s) 60, 131
BstMBI GATC 2 cut(s) 57, 128
BstNI CCWGG 1 cut(s) 192
BstSCI CCNGG 1 cut(s) 190
BstSFI CTRYAG 1 cut(s) 124
CviJI RGCY 2 cut(s) 190, 270
CviKI_1 RGCY 2 cut(s) 190, 270
DdeI CTNAG 1 cut(s) 264
DpnI GATC 2 cut(s) 59, 130
DpnII GATC 2 cut(s) 57, 128
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 190
FaiI YATR 3 cut(s) 62, 231, 280
FbaI TGATCA 1 cut(s) 57
HinfI GANTC 4 cut(s) 14, 106, 140, 246
Hpy188I TCNGA 4 cut(s) 57, 105, 185, 265
HpyAV CCTTC 2 cut(s) 61, 301
HpyCH4V TGCA 2 cut(s) 126, 259
HpyF3I CTNAG 1 cut(s) 264
Ksp22I TGATCA 1 cut(s) 57
Kzo9I GATC 2 cut(s) 57, 128
LpnPI CCDG 3 cut(s) 177, 204, 256
LweI GCATC 1 cut(s) 224
MalI GATC 2 cut(s) 59, 130
MboI GATC 2 cut(s) 57, 128
MboII GAAGA 2 cut(s) 80, 149
MluCI AATT 2 cut(s) 240, 296
MnlI CCTC 3 cut(s) 42, 58, 96
MseI TTAA 1 cut(s) 299
MspR9I CCNGG 1 cut(s) 192
MvaI CCWGG 1 cut(s) 192
NdeII GATC 2 cut(s) 57, 128
PfeI GAWTC 4 cut(s) 14, 106, 140, 246
Psp6I CCWGG 1 cut(s) 190
PspGI CCWGG 1 cut(s) 190
PstI CTGCAG 1 cut(s) 128
SaqAI TTAA 1 cut(s) 299
Sau3AI GATC 2 cut(s) 57, 128
ScrFI CCNGG 1 cut(s) 192
SetI ASST 2 cut(s) 34, 272
SfaNI GCATC 1 cut(s) 224
SfcI CTRYAG 1 cut(s) 124
SgeI CNNG 9 cut(s) 32, 61, 88, 179, 203, 204, 238, 283, 297
Sse9I AATT 2 cut(s) 240, 296
StyD4I CCNGG 1 cut(s) 190
TasI AATT 2 cut(s) 240, 296
TfiI GAWTC 4 cut(s) 14, 106, 140, 246
Tru1I TTAA 1 cut(s) 299
Tru9I TTAA 1 cut(s) 299
TspDTI ATGAA 2 cut(s) 80, 80
XcmI CCANNNNNNNNNTGG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.