Rh2DG630400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
85984476 .. 85984757
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG630400.1

Sequence Viewer

Length: 282 bp
ATGAAATTGCTATGGGAACTTCATCGACAGCCGTCAGGTGGGTGGATAAAGATGGTCGAGAATGGCAGAGCGGCGATCGGAGAGGTCGATGGTGGGGATTGGTTCGGCGTCGATGATGGCAGAGCGGCGATCGGAGAGGTCGATGGTGGGGATTGGTTCGGCGTCGATGATGGCAGAGCGGCGATCGGAGAGGTCAGAGAAGTCGATGGTGGGGATTGGTTGGGCGTCGATGATGGCAGAGCGGCGATCGGAGTGGAGGTCGAAGAGGTCGATGGTGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

9.8

Weight (kDa)

4.06

Isoelectric Point (pI)

17.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018652)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 4 cut(s) 71, 125, 179, 242
AciI CCGC 4 cut(s) 71, 125, 179, 242
AcyI GRCGYC 3 cut(s) 108, 162, 225
AfiI CCNNNNNNNGG 1 cut(s) 38
BccI CCATC 8 cut(s) 46, 83, 110, 137, 164, 200, 227, 266
BceAI ACGGC 1 cut(s) 16
BisI GCNGC 4 cut(s) 72, 126, 180, 243
BlsI GCNGC 4 cut(s) 73, 127, 181, 244
BoxI GACNNNNGTC 1 cut(s) 31
BsaHI GRCGYC 3 cut(s) 108, 162, 225
BsaXI ACNNNNNCTCC 2 cut(s) 243, 273
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseLI CCNNNNNNNGG 1 cut(s) 38
Bsh1285I CGRYCG 4 cut(s) 78, 132, 186, 249
BsiEI CGRYCG 4 cut(s) 78, 132, 186, 249
BslI CCNNNNNNNGG 1 cut(s) 38
Bsp143I GATC 4 cut(s) 75, 129, 183, 246
BspACI CCGC 4 cut(s) 71, 125, 179, 242
BsrBI CCGCTC 4 cut(s) 71, 125, 179, 242
BssMI GATC 4 cut(s) 75, 129, 183, 246
BssNI GRCGYC 3 cut(s) 108, 162, 225
Bst6I CTCTTC 1 cut(s) 258
BstACI GRCGYC 3 cut(s) 108, 162, 225
BstKTI GATC 4 cut(s) 78, 132, 186, 249
BstMBI GATC 4 cut(s) 75, 129, 183, 246
BstMCI CGRYCG 4 cut(s) 78, 132, 186, 249
BstPAI GACNNNNGTC 1 cut(s) 31
CseI GACGC 3 cut(s) 97, 151, 214
CviJI RGCY 1 cut(s) 31
CviKI_1 RGCY 1 cut(s) 31
DpnI GATC 4 cut(s) 77, 131, 185, 248
DpnII GATC 4 cut(s) 75, 129, 183, 246
Eam1104I CTCTTC 1 cut(s) 258
EarI CTCTTC 1 cut(s) 258
FaiI YATR 1 cut(s) 13
Fnu4HI GCNGC 4 cut(s) 72, 126, 180, 243
Fsp4HI GCNGC 4 cut(s) 72, 126, 180, 243
GluI GCNGC 4 cut(s) 72, 126, 180, 243
HgaI GACGC 3 cut(s) 97, 151, 214
Hin1I GRCGYC 3 cut(s) 108, 162, 225
Hpy188I TCNGA 5 cut(s) 80, 134, 188, 197, 251
Hpy188III TCNNGA 1 cut(s) 58
Hpy99I CGWCG 3 cut(s) 113, 167, 230
Hsp92I GRCGYC 3 cut(s) 108, 162, 225
Kzo9I GATC 4 cut(s) 75, 129, 183, 246
LpnPI CCDG 1 cut(s) 21
MalI GATC 4 cut(s) 77, 131, 185, 248
MbiI CCGCTC 4 cut(s) 71, 125, 179, 242
MboI GATC 4 cut(s) 75, 129, 183, 246
MboII GAAGA 1 cut(s) 275
MluCI AATT 1 cut(s) 5
MnlI CCTC 5 cut(s) 76, 130, 184, 250, 259
NdeII GATC 4 cut(s) 75, 129, 183, 246
PcsI WCGNNNNNNNCGW 3 cut(s) 84, 138, 267
PkrI GCNGC 4 cut(s) 73, 127, 181, 244
Ple19I CGATCG 4 cut(s) 78, 132, 186, 249
PshAI GACNNNNGTC 1 cut(s) 31
PvuI CGATCG 4 cut(s) 78, 132, 186, 249
SatI GCNGC 4 cut(s) 72, 126, 180, 243
Sau3AI GATC 4 cut(s) 75, 129, 183, 246
SetI ASST 6 cut(s) 40, 87, 141, 195, 261, 270
SgeI CNNG 2 cut(s) 48, 70
Sse9I AATT 1 cut(s) 5
SsiI CCGC 4 cut(s) 71, 125, 179, 242
TasI AATT 1 cut(s) 5
TauI GCSGC 4 cut(s) 74, 128, 182, 245
TspDTI ATGAA 2 cut(s) 11, 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.