Rh7CG411700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
52874457 .. 52874639
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG411700.1

Sequence Viewer

Length: 183 bp
ATGAAATTGCTATGGGAACTTCGTCGACAGCCGTCAGGTGGGTGGATAAAGATGGTCGACGATGGCAGAGCGGCGATGGGAGAGGTCAATGGTGGGGATTGGTTCGGCGTCGATGATGGCAGAGCGGCGATCAAAGAGGTCGATGGTGGGGATTGGTTGGGCGTCGGGTCGGGTCGTCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.53

Weight (kDa)

5.16

Isoelectric Point (pI)

44.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018652)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 71, 125
AccI GTMKAC 2 cut(s) 25, 57
AciI CCGC 2 cut(s) 71, 125
AcyI GRCGYC 2 cut(s) 108, 162
AfiI CCNNNNNNNGG 1 cut(s) 38
BccI CCATC 5 cut(s) 46, 56, 70, 110, 137
BceAI ACGGC 1 cut(s) 16
BisI GCNGC 2 cut(s) 72, 126
BlsI GCNGC 2 cut(s) 73, 127
BoxI GACNNNNGTC 1 cut(s) 31
BsaHI GRCGYC 2 cut(s) 108, 162
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseLI CCNNNNNNNGG 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 38
Bsp143I GATC 1 cut(s) 129
BspACI CCGC 2 cut(s) 71, 125
BsrBI CCGCTC 2 cut(s) 71, 125
BssMI GATC 1 cut(s) 129
BssNI GRCGYC 2 cut(s) 108, 162
BstACI GRCGYC 2 cut(s) 108, 162
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BstPAI GACNNNNGTC 1 cut(s) 31
BtgZI GCGATG 1 cut(s) 89
CseI GACGC 2 cut(s) 97, 151
CviJI RGCY 1 cut(s) 31
CviKI_1 RGCY 1 cut(s) 31
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
FaiI YATR 1 cut(s) 13
FblI GTMKAC 2 cut(s) 25, 57
Fnu4HI GCNGC 2 cut(s) 72, 126
Fsp4HI GCNGC 2 cut(s) 72, 126
GluI GCNGC 2 cut(s) 72, 126
HgaI GACGC 2 cut(s) 97, 151
Hin1I GRCGYC 2 cut(s) 108, 162
HincII GTYRAC 2 cut(s) 26, 58
HindII GTYRAC 2 cut(s) 26, 58
Hpy166II GTNNAC 2 cut(s) 26, 58
Hpy8I GTNNAC 2 cut(s) 26, 58
Hpy99I CGWCG 5 cut(s) 27, 62, 113, 167, 180
Hsp92I GRCGYC 2 cut(s) 108, 162
Kzo9I GATC 1 cut(s) 129
LpnPI CCDG 1 cut(s) 21
MalI GATC 1 cut(s) 131
MbiI CCGCTC 2 cut(s) 71, 125
MboI GATC 1 cut(s) 129
MluCI AATT 1 cut(s) 5
MnlI CCTC 2 cut(s) 76, 130
NdeII GATC 1 cut(s) 129
PkrI GCNGC 2 cut(s) 73, 127
PshAI GACNNNNGTC 1 cut(s) 31
SalI GTCGAC 2 cut(s) 24, 56
SatI GCNGC 2 cut(s) 72, 126
Sau3AI GATC 1 cut(s) 129
SetI ASST 3 cut(s) 40, 87, 141
SgeI CNNG 2 cut(s) 48, 178
Sse9I AATT 1 cut(s) 5
SsiI CCGC 2 cut(s) 71, 125
TaqI TCGA 4 cut(s) 25, 57, 111, 141
TasI AATT 1 cut(s) 5
TauI GCSGC 2 cut(s) 74, 128
TspDTI ATGAA 1 cut(s) 17
XmiI GTMKAC 2 cut(s) 25, 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.