Rh6BG090300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
14182406 .. 14182594
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG090300.1

Sequence Viewer

Length: 189 bp
ATGGCAGAGCGGCGATCGGAGAGGTCGATGGTGGGGATTGGTTCGGCGTCGATGATGGCAGAGCGGCGATCGGAGAGGTCGGAGAAGTCGATGGTGGGGATTGGTTGGGCGTCGATGATGGCAGAGCGGCGATCGGAGTGGAGGTCGGAGAGGTCGATGGTGGGGATTCGTTGGGCGTCGGGTCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.11

Weight (kDa)

11.53

Isoelectric Point (pI)

103.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018652)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 3 cut(s) 10, 64, 127
AciI CCGC 3 cut(s) 10, 64, 127
AcyI GRCGYC 3 cut(s) 47, 110, 176
BccI CCATC 5 cut(s) 22, 49, 85, 112, 151
BisI GCNGC 3 cut(s) 11, 65, 128
BlsI GCNGC 3 cut(s) 12, 66, 129
BsaHI GRCGYC 3 cut(s) 47, 110, 176
BsaXI ACNNNNNCTCC 2 cut(s) 128, 158
Bsh1285I CGRYCG 3 cut(s) 17, 71, 134
BsiEI CGRYCG 3 cut(s) 17, 71, 134
Bsp143I GATC 3 cut(s) 14, 68, 131
BspACI CCGC 3 cut(s) 10, 64, 127
BsrBI CCGCTC 3 cut(s) 10, 64, 127
BssMI GATC 3 cut(s) 14, 68, 131
BssNI GRCGYC 3 cut(s) 47, 110, 176
BstACI GRCGYC 3 cut(s) 47, 110, 176
BstKTI GATC 3 cut(s) 17, 71, 134
BstMBI GATC 3 cut(s) 14, 68, 131
BstMCI CGRYCG 3 cut(s) 17, 71, 134
CseI GACGC 3 cut(s) 36, 99, 165
DpnI GATC 3 cut(s) 16, 70, 133
DpnII GATC 3 cut(s) 14, 68, 131
Fnu4HI GCNGC 3 cut(s) 11, 65, 128
Fsp4HI GCNGC 3 cut(s) 11, 65, 128
GluI GCNGC 3 cut(s) 11, 65, 128
HgaI GACGC 3 cut(s) 36, 99, 165
Hin1I GRCGYC 3 cut(s) 47, 110, 176
HinfI GANTC 1 cut(s) 166
Hpy188I TCNGA 5 cut(s) 19, 73, 82, 136, 148
Hpy99I CGWCG 3 cut(s) 52, 115, 181
Hsp92I GRCGYC 3 cut(s) 47, 110, 176
Kzo9I GATC 3 cut(s) 14, 68, 131
MalI GATC 3 cut(s) 16, 70, 133
MbiI CCGCTC 3 cut(s) 10, 64, 127
MboI GATC 3 cut(s) 14, 68, 131
MmeI TCCRAC 2 cut(s) 60, 126
MnlI CCTC 4 cut(s) 15, 69, 135, 144
NdeII GATC 3 cut(s) 14, 68, 131
PcsI WCGNNNNNNNCGW 3 cut(s) 23, 86, 152
PfeI GAWTC 1 cut(s) 166
PkrI GCNGC 3 cut(s) 12, 66, 129
Ple19I CGATCG 3 cut(s) 17, 71, 134
PvuI CGATCG 3 cut(s) 17, 71, 134
SatI GCNGC 3 cut(s) 11, 65, 128
Sau3AI GATC 3 cut(s) 14, 68, 131
SetI ASST 4 cut(s) 26, 80, 146, 155
SsiI CCGC 3 cut(s) 10, 64, 127
TaqI TCGA 5 cut(s) 26, 50, 89, 113, 155
TauI GCSGC 3 cut(s) 13, 67, 130
TfiI GAWTC 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.