Rh7DG011600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
974773 .. 974985
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG011600.1

Sequence Viewer

Length: 213 bp
ATGGTCGACAATGGCAGAGCGGCGATCGGAGAGGTCGATGGTGGGGATTGGTTCGGCGTCGATGATGGCAGAGCGACGATGGCAGAGCGGCGATCGGAGAGGTCGGAGAAGTCGATGGTGGGGATTGGTTGGGTGTCGATGATGGCAGAGCGGCGATCGGAGTGGAGGTCGGAGAGGTCGATGGTGGGGATTCGTTGGGCGTCGGGTCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.87

Weight (kDa)

6.24

Isoelectric Point (pI)

63.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018652)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 3 cut(s) 20, 88, 151
AccI GTMKAC 1 cut(s) 6
AciI CCGC 3 cut(s) 20, 88, 151
AcyI GRCGYC 2 cut(s) 57, 200
BccI CCATC 6 cut(s) 32, 59, 73, 109, 136, 175
BisI GCNGC 3 cut(s) 21, 89, 152
BlsI GCNGC 3 cut(s) 22, 90, 153
BsaHI GRCGYC 2 cut(s) 57, 200
BsaXI ACNNNNNCTCC 2 cut(s) 152, 182
Bsh1285I CGRYCG 3 cut(s) 27, 95, 158
BsiEI CGRYCG 3 cut(s) 27, 95, 158
Bsp143I GATC 3 cut(s) 24, 92, 155
BspACI CCGC 3 cut(s) 20, 88, 151
BsrBI CCGCTC 3 cut(s) 20, 88, 151
BssMI GATC 3 cut(s) 24, 92, 155
BssNI GRCGYC 2 cut(s) 57, 200
BstACI GRCGYC 2 cut(s) 57, 200
BstKTI GATC 3 cut(s) 27, 95, 158
BstMBI GATC 3 cut(s) 24, 92, 155
BstMCI CGRYCG 3 cut(s) 27, 95, 158
BstMWI GCNNNNNNNGC 1 cut(s) 80
CseI GACGC 2 cut(s) 46, 189
DpnI GATC 3 cut(s) 26, 94, 157
DpnII GATC 3 cut(s) 24, 92, 155
FblI GTMKAC 1 cut(s) 6
Fnu4HI GCNGC 3 cut(s) 21, 89, 152
Fsp4HI GCNGC 3 cut(s) 21, 89, 152
GluI GCNGC 3 cut(s) 21, 89, 152
HgaI GACGC 2 cut(s) 46, 189
Hin1I GRCGYC 2 cut(s) 57, 200
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
HinfI GANTC 1 cut(s) 190
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 5 cut(s) 29, 97, 106, 160, 172
Hpy8I GTNNAC 1 cut(s) 7
Hpy99I CGWCG 3 cut(s) 62, 79, 205
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
Hsp92I GRCGYC 2 cut(s) 57, 200
Kzo9I GATC 3 cut(s) 24, 92, 155
MalI GATC 3 cut(s) 26, 94, 157
MbiI CCGCTC 3 cut(s) 20, 88, 151
MboI GATC 3 cut(s) 24, 92, 155
MmeI TCCRAC 2 cut(s) 84, 150
MnlI CCTC 4 cut(s) 25, 93, 159, 168
MwoI GCNNNNNNNGC 1 cut(s) 80
NdeII GATC 3 cut(s) 24, 92, 155
PcsI WCGNNNNNNNCGW 3 cut(s) 33, 110, 176
PfeI GAWTC 1 cut(s) 190
PkrI GCNGC 3 cut(s) 22, 90, 153
Ple19I CGATCG 3 cut(s) 27, 95, 158
PvuI CGATCG 3 cut(s) 27, 95, 158
SalI GTCGAC 1 cut(s) 5
SatI GCNGC 3 cut(s) 21, 89, 152
Sau3AI GATC 3 cut(s) 24, 92, 155
SetI ASST 4 cut(s) 36, 104, 170, 179
SsiI CCGC 3 cut(s) 20, 88, 151
TaqI TCGA 6 cut(s) 6, 36, 60, 113, 137, 179
TauI GCSGC 3 cut(s) 23, 91, 154
TfiI GAWTC 1 cut(s) 190
XmiI GTMKAC 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.