Rh4CG235200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
47883740 .. 47884012
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG235200.1

Sequence Viewer

Length: 273 bp
ATGGCAACTCGCCCAGAATTCACCAATTCTCAAAAAATTGATGATCTGTCCTATAAGCTAAGCCAAATTCTTGCAAAAGCTAACTCCAAAGTTAGTGACCTCCTTCAAGAAAATGGTGAGGCTTCCCCTGAAGTTCTCCAAAAGCTTCGTCAAGCCCAGAGATCGATCAAAGATCTCATCTTGGAGTGCAACAACCCCATTCCTAATGCTGAGAGCGTTCTACAAACCCTTTGCATTTCTGGAAACTTTATCAGTCGGTTTCTGGAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.05

Weight (kDa)

5.33

Isoelectric Point (pI)

52.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018425)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 17, 66
AcuI CTGAAG 1 cut(s) 150
AgsI TTSAA 1 cut(s) 107
AluBI AGCT 3 cut(s) 58, 80, 145
AluI AGCT 3 cut(s) 58, 80, 145
ApoI RAATTY 2 cut(s) 17, 66
ArsI GACNNNNNNTTYG 2 cut(s) 133, 165
AsuHPI GGTGA 2 cut(s) 13, 128
BglII AGATCT 1 cut(s) 172
BlpI GCTNAGC 1 cut(s) 59
Bpu1102I GCTNAGC 1 cut(s) 59
Bsa29I ATCGAT 1 cut(s) 164
BseCI ATCGAT 1 cut(s) 164
BseMII CTCAG 1 cut(s) 201
BshVI ATCGAT 1 cut(s) 164
Bsp143I GATC 4 cut(s) 43, 161, 165, 172
Bsp1720I GCTNAGC 1 cut(s) 59
BspCNI CTCAG 1 cut(s) 202
BspDI ATCGAT 1 cut(s) 164
BssMI GATC 4 cut(s) 43, 161, 165, 172
BstDEI CTNAG 2 cut(s) 59, 210
BstKTI GATC 4 cut(s) 46, 164, 168, 175
BstMBI GATC 4 cut(s) 43, 161, 165, 172
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
Bsu15I ATCGAT 1 cut(s) 164
BsuTUI ATCGAT 1 cut(s) 164
ClaI ATCGAT 1 cut(s) 164
CviJI RGCY 6 cut(s) 58, 63, 80, 122, 145, 155
CviKI_1 RGCY 6 cut(s) 58, 63, 80, 122, 145, 155
DdeI CTNAG 2 cut(s) 59, 210
DpnI GATC 4 cut(s) 45, 163, 167, 174
DpnII GATC 4 cut(s) 43, 161, 165, 172
Eco57I CTGAAG 1 cut(s) 150
EcoRI GAATTC 1 cut(s) 17
FaiI YATR 1 cut(s) 54
HindIII AAGCTT 1 cut(s) 143
HinfI GANTC 1 cut(s) 266
HphI GGTGA 2 cut(s) 13, 128
Hpy188III TCNNGA 4 cut(s) 107, 240, 263, 270
HpyAV CCTTC 1 cut(s) 113
HpyCH4V TGCA 3 cut(s) 74, 189, 234
HpyF3I CTNAG 2 cut(s) 59, 210
Kzo9I GATC 4 cut(s) 43, 161, 165, 172
LpnPI CCDG 5 cut(s) 27, 141, 170, 225, 248
MaeIII GTNAC 1 cut(s) 95
MalI GATC 4 cut(s) 45, 163, 167, 174
MboI GATC 4 cut(s) 43, 161, 165, 172
MflI RGATCY 1 cut(s) 172
MluCI AATT 4 cut(s) 17, 25, 36, 66
MnlI CCTC 2 cut(s) 110, 112
NdeII GATC 4 cut(s) 43, 161, 165, 172
NmuCI GTSAC 1 cut(s) 95
PfeI GAWTC 1 cut(s) 266
PsuI RGATCY 1 cut(s) 172
Sau3AI GATC 4 cut(s) 43, 161, 165, 172
SetI ASST 4 cut(s) 60, 82, 102, 147
SgeI CNNG 9 cut(s) 21, 26, 83, 119, 140, 164, 169, 193, 252
Sse9I AATT 4 cut(s) 17, 25, 36, 66
TaqI TCGA 1 cut(s) 164
TasI AATT 4 cut(s) 17, 25, 36, 66
TfiI GAWTC 1 cut(s) 266
TseFI GTSAC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 95
XapI RAATTY 2 cut(s) 17, 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.