Rh5AG168700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0017825
Physical Location & Seq
Forward (+)
18592690 .. 18642619
49930 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG168700.1

Sequence Viewer

Length: 447 bp
ATGCGGGTGTTGATTATTTCAGGAATTGAAGTGATATGGTTTTACTACGATCTCATCTTGGAATGTACTCAGAGTAAGAATTCTGTGGTAACTGGGAGTGAAGCTGTAGATGACATATGCAAGTTACCCTCGAAAGGTATGGTGCAAATTATGCAAGGTGGGAATGCAGCAGGTGAACCTGAAGTTGCACAAGTGCATGTTCAGCCTGATAATGATGCACCTAATGTTCAACCAGTAGCAGAGAACACAAAAGAAGTCCACATTCCAGATGGTGGGATTATCTCGCCGAGGAGAATCTTGCCTGGGCATTTCCAACACAATAGATCTGACATAGTATCCCCCTTTCAGGAAACTGAAGCATATGAGAAGAATAGATATCAACTCCAACTTGAGGAGGCCATTACTAACAATGACAACAAAACTTGCGCATTCTTAGCTTACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.5

Weight (kDa)

4.88

Isoelectric Point (pI)

56.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 161
Acc16I TGCGCA 1 cut(s) 427
Acc36I ACCTGC 1 cut(s) 161
AccB7I CCANNNNNTGG 1 cut(s) 272
AciI CCGC 1 cut(s) 4
AcsI RAATTY 1 cut(s) 79
AcuI CTGAAG 2 cut(s) 201, 375
AfaI GTAC 1 cut(s) 67
AfiI CCNNNNNNNGG 4 cut(s) 134, 272, 346, 391
AgsI TTSAA 2 cut(s) 29, 230
AjnI CCWGG 1 cut(s) 301
AluBI AGCT 2 cut(s) 104, 437
AluI AGCT 2 cut(s) 104, 437
AoxI GGCC 1 cut(s) 396
ApeKI GCWGC 1 cut(s) 167
ApoI RAATTY 1 cut(s) 79
AspLEI GCGC 1 cut(s) 428
AsuHPI GGTGA 1 cut(s) 185
BbvI GCAGC 1 cut(s) 179
BccI CCATC 1 cut(s) 263
BciT130I CCWGG 1 cut(s) 303
BciVI GTATCC 1 cut(s) 346
BfmI CTRYAG 1 cut(s) 105
BfuAI ACCTGC 1 cut(s) 161
BfuI GTATCC 1 cut(s) 346
BglII AGATCT 1 cut(s) 323
BisI GCNGC 1 cut(s) 168
BlsI GCNGC 1 cut(s) 169
Bme1390I CCNGG 1 cut(s) 303
BmrFI CCNGG 1 cut(s) 303
BmrI ACTGGG 1 cut(s) 102
BmsI GCATC 1 cut(s) 205
BmuI ACTGGG 1 cut(s) 102
BpuEI CTTGAG 1 cut(s) 410
BsaJI CCNNGG 2 cut(s) 287, 302
Bsc4I CCNNNNNNNGG 4 cut(s) 134, 272, 346, 391
Bse1I ACTGG 2 cut(s) 97, 233
BseBI CCWGG 1 cut(s) 303
BseDI CCNNGG 2 cut(s) 287, 302
BseLI CCNNNNNNNGG 4 cut(s) 134, 272, 346, 391
BseMII CTCAG 1 cut(s) 83
BseNI ACTGG 2 cut(s) 97, 233
BseRI GAGGAG 2 cut(s) 304, 407
BseXI GCAGC 1 cut(s) 179
BshFI GGCC 1 cut(s) 398
BslI CCNNNNNNNGG 4 cut(s) 134, 272, 346, 391
BsmI GAATGC 2 cut(s) 169, 428
BsnI GGCC 1 cut(s) 398
Bsp143I GATC 2 cut(s) 49, 323
BspACI CCGC 1 cut(s) 4
BspANI GGCC 1 cut(s) 398
BspCNI CTCAG 1 cut(s) 82
BspMI ACCTGC 1 cut(s) 161
BsrI ACTGG 2 cut(s) 97, 233
BssECI CCNNGG 2 cut(s) 287, 302
BssMI GATC 2 cut(s) 49, 323
Bst2UI CCWGG 1 cut(s) 303
BstAPI GCANNNNNTGC 1 cut(s) 151
BstDEI CTNAG 2 cut(s) 69, 433
BstHHI GCGC 1 cut(s) 428
BstKTI GATC 2 cut(s) 52, 326
BstMBI GATC 2 cut(s) 49, 323
BstMWI GCNNNNNNNGC 3 cut(s) 151, 202, 434
BstNI CCWGG 1 cut(s) 303
BstNSI RCATGY 1 cut(s) 200
BstSCI CCNGG 1 cut(s) 301
BstSFI CTRYAG 1 cut(s) 105
BstV1I GCAGC 1 cut(s) 179
BstX2I RGATCY 1 cut(s) 323
BstYI RGATCY 1 cut(s) 323
BsuI GTATCC 1 cut(s) 346
BsuRI GGCC 1 cut(s) 398
BveI ACCTGC 1 cut(s) 161
CfoI GCGC 1 cut(s) 428
Csp6I GTAC 1 cut(s) 66
CviAII CATG 1 cut(s) 197
CviJI RGCY 4 cut(s) 104, 205, 398, 437
CviKI_1 RGCY 4 cut(s) 104, 205, 398, 437
CviQI GTAC 1 cut(s) 66
DdeI CTNAG 2 cut(s) 69, 433
DpnI GATC 2 cut(s) 51, 325
DpnII GATC 2 cut(s) 49, 323
Eco32I GATATC 1 cut(s) 377
Eco57I CTGAAG 2 cut(s) 201, 375
EcoRI GAATTC 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 301
EcoRV GATATC 1 cut(s) 377
FaeI CATG 1 cut(s) 200
FaiI YATR 9 cut(s) 37, 116, 118, 140, 152, 198, 332, 361, 363
FatI CATG 1 cut(s) 196
FauNDI CATATG 2 cut(s) 116, 361
Fnu4HI GCNGC 1 cut(s) 168
Fsp4HI GCNGC 1 cut(s) 168
FspI TGCGCA 1 cut(s) 427
GlaI GCGC 1 cut(s) 427
GluI GCNGC 1 cut(s) 168
HaeIII GGCC 1 cut(s) 398
HhaI GCGC 1 cut(s) 428
Hin1II CATG 1 cut(s) 200
Hin6I GCGC 1 cut(s) 426
HinP1I GCGC 1 cut(s) 426
HinfI GANTC 1 cut(s) 294
HphI GGTGA 1 cut(s) 185
Hpy166II GTNNAC 2 cut(s) 176, 259
Hpy188I TCNGA 2 cut(s) 72, 328
Hpy188III TCNNGA 3 cut(s) 21, 266, 347
Hpy8I GTNNAC 2 cut(s) 176, 259
HpyCH4V TGCA 7 cut(s) 120, 145, 154, 167, 188, 196, 218
HpyF10VI GCNNNNNNNGC 3 cut(s) 151, 202, 434
HpyF3I CTNAG 2 cut(s) 69, 433
Hsp92II CATG 1 cut(s) 200
HspAI GCGC 1 cut(s) 426
Kzo9I GATC 2 cut(s) 49, 323
Lsp1109I GCAGC 1 cut(s) 179
LweI GCATC 1 cut(s) 205
MaeIII GTNAC 2 cut(s) 88, 123
MalI GATC 2 cut(s) 51, 325
MboI GATC 2 cut(s) 49, 323
MboII GAAGA 1 cut(s) 379
MflI RGATCY 1 cut(s) 323
MluCI AATT 3 cut(s) 24, 79, 147
MmeI TCCRAC 2 cut(s) 337, 409
MnlI CCTC 4 cut(s) 139, 282, 385, 388
MspR9I CCNGG 1 cut(s) 303
Mva1269I GAATGC 2 cut(s) 169, 428
MvaI CCWGG 1 cut(s) 303
MwoI GCNNNNNNNGC 3 cut(s) 151, 202, 434
NdeI CATATG 2 cut(s) 116, 361
NdeII GATC 2 cut(s) 49, 323
NlaIII CATG 1 cut(s) 200
NmeAIII GCCGAG 1 cut(s) 312
NsbI TGCGCA 1 cut(s) 427
NspI RCATGY 1 cut(s) 200
PaqCI CACCTGC 1 cut(s) 161
PctI GAATGC 2 cut(s) 169, 428
PfeI GAWTC 1 cut(s) 294
PflMI CCANNNNNTGG 1 cut(s) 272
PkrI GCNGC 1 cut(s) 169
Psp6I CCWGG 1 cut(s) 301
PspGI CCWGG 1 cut(s) 301
PsuI RGATCY 1 cut(s) 323
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
SatI GCNGC 1 cut(s) 168
Sau3AI GATC 2 cut(s) 49, 323
ScrFI CCNGG 1 cut(s) 303
SetI ASST 7 cut(s) 106, 139, 160, 175, 181, 223, 439
SfaNI GCATC 1 cut(s) 205
SfcI CTRYAG 1 cut(s) 105
SmlI CTYRAG 1 cut(s) 389
SmoI CTYRAG 1 cut(s) 389
Sse9I AATT 3 cut(s) 24, 79, 147
SsiI CCGC 1 cut(s) 4
StyD4I CCNGG 1 cut(s) 301
TaqI TCGA 1 cut(s) 131
TasI AATT 3 cut(s) 24, 79, 147
TatI WGTACW 1 cut(s) 65
TfiI GAWTC 1 cut(s) 294
TseI GCWGC 1 cut(s) 167
Van91I CCANNNNNTGG 1 cut(s) 272
XapI RAATTY 1 cut(s) 79
XceI RCATGY 1 cut(s) 200
XcmI CCANNNNNNNNNTGG 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.