Rh5CG110900

Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0010657
Physical Location & Seq
Forward (+)
9125878 .. 9126711
834 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG110900.1

Sequence Viewer

Length: 204 bp
ATGGGAACGCTTCTGATTTCCAAGATTAGGGAGGAGTACCCAGATCGGATGATGATGACTTTCATTGTGTTCCCATCTTCCAAGGTATCAGATACTGTTGTGGAGTCTTACAATGCTACTTTGTCTGTTCTTCAGCTTGTGGAGAATCCATACTTGAACTCACTAGCCCCAACTGAGAATGGTTTTGAGGGTCAGACGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04145 ko04540 ko05130 map04145 map04540 map05130
Pfam Domains
Protein Families
Tubulin Tubulin_C

Protein Analysis

67

Amino Acids

7.53

Weight (kDa)

4.6

Isoelectric Point (pI)

26.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tubulin PF00091 2 - 49 2.1e-07 Tubulin/FtsZ family, GTPase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 116
AfaI GTAC 1 cut(s) 38
AfiI CCNNNNNNNGG 1 cut(s) 27
AgsI TTSAA 1 cut(s) 157
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
AlwNI CAGNNNCTG 1 cut(s) 95
BaeI ACNNNNGTAYC 2 cut(s) 84, 117
BccI CCATC 1 cut(s) 82
BfaI CTAG 1 cut(s) 164
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 81
BseGI GGATG 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 27
BseMII CTCAG 1 cut(s) 165
BseRI GAGGAG 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 27
Bsp143I GATC 1 cut(s) 43
BspCNI CTCAG 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 43
BssT1I CCWWGG 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 1 cut(s) 54
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BtsCI GGATG 1 cut(s) 54
CaiI CAGNNNCTG 1 cut(s) 95
Csp6I GTAC 1 cut(s) 37
CviJI RGCY 2 cut(s) 136, 167
CviKI_1 RGCY 2 cut(s) 136, 167
CviQI GTAC 1 cut(s) 37
DdeI CTNAG 1 cut(s) 174
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 116
EcoT14I CCWWGG 1 cut(s) 81
ErhI CCWWGG 1 cut(s) 81
FaiI YATR 1 cut(s) 151
FokI GGATG 1 cut(s) 61
FspBI CTAG 1 cut(s) 164
HinfI GANTC 2 cut(s) 104, 145
Hpy188I TCNGA 4 cut(s) 15, 48, 91, 195
HpyCH4III ACNGT 1 cut(s) 97
HpyF3I CTNAG 1 cut(s) 174
Kzo9I GATC 1 cut(s) 43
LpnPI CCDG 1 cut(s) 54
MaeI CTAG 1 cut(s) 164
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MboII GAAGA 2 cut(s) 69, 122
MlyI GAGTC 1 cut(s) 113
MnlI CCTC 2 cut(s) 25, 181
NdeII GATC 1 cut(s) 43
PfeI GAWTC 1 cut(s) 145
PleI GAGTC 1 cut(s) 112
PpsI GAGTC 1 cut(s) 112
PstNI CAGNNNCTG 1 cut(s) 95
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
Sau3AI GATC 1 cut(s) 43
SchI GAGTC 1 cut(s) 113
SetI ASST 2 cut(s) 87, 138
SgeI CNNG 6 cut(s) 34, 53, 94, 149, 166, 176
SspMI CTAG 1 cut(s) 164
StyI CCWWGG 1 cut(s) 81
TaaI ACNGT 1 cut(s) 97
TfiI GAWTC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 52
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.