Rh5DG374100
MYB Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
56687711 .. 56688172
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG374100.1

Sequence Viewer

Length: 462 bp
ATGCCCATTTACGGGGATTCATCCATGCAATCAACCTCCCTCATCAACCACATGTTTGATCCCTTTCCAATGGTCGAGCATGGCGGGTACTACAACAATGGAAACCCATGCACTGCACAGATCGGATCATCAGTTGGTAGTGGTGCTGATGATTGTGGGTTTGAAGAAAATATTGAAGCGTTTGGGAACGTCAATATCGGGGTAGAAGAAGACATCTTTGTGCCTCCCCTAGAGAGTGTAAGCACCACTGACCAGGATCAAAATCTAAAAACGGAAACTATCTTCTATGATAATAATAATTACTACAGTAACAGTAACAATATCATCAAAGGTGAAAACATGATCGGGGTTGGGAATTACTTTGAAGATGATCAGGATCAAGGGCTAACAATGGGAGAGTGGGACTTGGAGGATCTGATGAAAGATGTTTCCTCCTTTCCTTTTCTTGACTACCAGAGTTGA

Protein Analysis

153

Amino Acids

17.01

Weight (kDa)

4.05

Isoelectric Point (pI)

52.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013417)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 84
AclWI GGATC 5 cut(s) 53, 133, 264, 384, 420
AfaI GTAC 1 cut(s) 89
AfiI CCNNNNNNNGG 2 cut(s) 11, 12
AflIII ACRYGT 1 cut(s) 51
AgsI TTSAA 3 cut(s) 164, 176, 365
AjnI CCWGG 1 cut(s) 252
AlwI GGATC 5 cut(s) 53, 133, 264, 384, 420
AsuHPI GGTGA 1 cut(s) 344
BbsI GAAGAC 1 cut(s) 216
BciT130I CCWGG 1 cut(s) 254
BclI TGATCA 1 cut(s) 370
BfaI CTAG 1 cut(s) 230
BfmI CTRYAG 1 cut(s) 304
Bme1390I CCNGG 1 cut(s) 254
BmrFI CCNGG 1 cut(s) 254
BpiI GAAGAC 1 cut(s) 216
BsaBI GATNNNNATC 2 cut(s) 261, 375
Bsc4I CCNNNNNNNGG 2 cut(s) 11, 12
Bse8I GATNNNNATC 2 cut(s) 261, 375
BseBI CCWGG 1 cut(s) 254
BseGI GGATG 1 cut(s) 20
BseJI GATNNNNATC 2 cut(s) 261, 375
BseLI CCNNNNNNNGG 2 cut(s) 11, 12
BsgI GTGCAG 1 cut(s) 99
BslFI GGGAC 1 cut(s) 416
BslI CCNNNNNNNGG 2 cut(s) 11, 12
BsmFI GGGAC 1 cut(s) 416
Bsp143I GATC 8 cut(s) 58, 120, 125, 256, 342, 370, 376, 412
BspACI CCGC 1 cut(s) 84
BspPI GGATC 5 cut(s) 53, 133, 264, 384, 420
BssMI GATC 8 cut(s) 58, 120, 125, 256, 342, 370, 376, 412
Bst2UI CCWGG 1 cut(s) 254
Bst4CI ACNGT 2 cut(s) 308, 314
BstF5I GGATG 1 cut(s) 20
BstKTI GATC 8 cut(s) 61, 123, 128, 259, 345, 373, 379, 415
BstMBI GATC 8 cut(s) 58, 120, 125, 256, 342, 370, 376, 412
BstNI CCWGG 1 cut(s) 254
BstNSI RCATGY 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 252
BstSFI CTRYAG 1 cut(s) 304
BstV2I GAAGAC 1 cut(s) 216
BstX2I RGATCY 1 cut(s) 412
BstYI RGATCY 1 cut(s) 412
BtsCI GGATG 1 cut(s) 20
BtsI GCAGTG 1 cut(s) 111
BtsIMutI CAGTG 2 cut(s) 111, 246
Csp6I GTAC 1 cut(s) 88
CviAII CATG 5 cut(s) 25, 52, 80, 108, 340
CviJI RGCY 1 cut(s) 385
CviKI_1 RGCY 1 cut(s) 385
CviQI GTAC 1 cut(s) 88
DpnI GATC 8 cut(s) 60, 122, 127, 258, 344, 372, 378, 414
DpnII GATC 8 cut(s) 58, 120, 125, 256, 342, 370, 376, 412
EcoRII CCWGG 1 cut(s) 252
FaeI CATG 5 cut(s) 28, 55, 83, 111, 343
FaiI YATR 6 cut(s) 26, 53, 81, 109, 288, 341
FaqI GGGAC 1 cut(s) 416
FatI CATG 5 cut(s) 24, 51, 79, 107, 339
FauI CCCGC 1 cut(s) 77
FbaI TGATCA 1 cut(s) 370
FokI GGATG 1 cut(s) 7
FspBI CTAG 1 cut(s) 230
Hin1II CATG 5 cut(s) 28, 55, 83, 111, 343
HinfI GANTC 1 cut(s) 17
HphI GGTGA 1 cut(s) 344
Hpy188I TCNGA 2 cut(s) 125, 417
Hpy188III TCNNGA 2 cut(s) 374, 446
HpyCH4III ACNGT 2 cut(s) 308, 314
HpyCH4IV ACGT 1 cut(s) 189
HpyCH4V TGCA 3 cut(s) 28, 111, 116
HpySE526I ACGT 1 cut(s) 189
Hsp92II CATG 5 cut(s) 28, 55, 83, 111, 343
Ksp22I TGATCA 1 cut(s) 370
Kzo9I GATC 8 cut(s) 58, 120, 125, 256, 342, 370, 376, 412
LpnPI CCDG 3 cut(s) 239, 266, 359
MaeI CTAG 1 cut(s) 230
MaeII ACGT 1 cut(s) 189
MaeIII GTNAC 2 cut(s) 308, 314
MalI GATC 8 cut(s) 60, 122, 127, 258, 344, 372, 378, 414
MboI GATC 8 cut(s) 58, 120, 125, 256, 342, 370, 376, 412
MboII GAAGA 5 cut(s) 176, 218, 221, 274, 377
MflI RGATCY 1 cut(s) 412
MluCI AATT 2 cut(s) 298, 355
MnlI CCTC 5 cut(s) 46, 50, 234, 403, 442
MslI CAYNNNNRTG 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 254
MvaI CCWGG 1 cut(s) 254
NdeII GATC 8 cut(s) 58, 120, 125, 256, 342, 370, 376, 412
NlaIII CATG 5 cut(s) 28, 55, 83, 111, 343
NspI RCATGY 1 cut(s) 55
PciI ACATGT 1 cut(s) 51
PfeI GAWTC 1 cut(s) 17
PscI ACATGT 1 cut(s) 51
Psp6I CCWGG 1 cut(s) 252
PspGI CCWGG 1 cut(s) 252
PsuI RGATCY 1 cut(s) 412
RsaI GTAC 1 cut(s) 89
RsaNI GTAC 1 cut(s) 88
RseI CAYNNNNRTG 1 cut(s) 218
Sau3AI GATC 8 cut(s) 58, 120, 125, 256, 342, 370, 376, 412
ScrFI CCNGG 1 cut(s) 254
SetI ASST 3 cut(s) 38, 192, 334
SfcI CTRYAG 1 cut(s) 304
SmiMI CAYNNNNRTG 1 cut(s) 218
Sse9I AATT 2 cut(s) 298, 355
SsiI CCGC 1 cut(s) 84
SspI AATATT 1 cut(s) 172
SspMI CTAG 1 cut(s) 230
StyD4I CCNGG 1 cut(s) 252
TaaI ACNGT 2 cut(s) 308, 314
TaiI ACGT 1 cut(s) 192
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 298, 355
TfiI GAWTC 1 cut(s) 17
TscAI CASTG 2 cut(s) 118, 253
TspDTI ATGAA 2 cut(s) 9, 434
TspGWI ACGGA 1 cut(s) 287
TspRI CASTG 2 cut(s) 118, 253
XceI RCATGY 1 cut(s) 55
XspI CTAG 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.