Rh6BG055300

Epidermal patterning factor proteins

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
8933787 .. 8934218
432 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG055300.1

Sequence Viewer

Length: 327 bp
ATGCATCGAGAAGCGAATAGTAGAACACTAATTTTGGTCCTCTTTCTCGCCTTGCTCATCTGTTCTGGCTCGGTTCACTCGTGCGACTTCTCAAGCTCTCCTTCGCCTTCACCGGCCCTTGGGATGCCAACACCCCACGAGCCATCTAAAGGGATTTTCAAAAAGAAAAGGAGAGGGTCTTTCCCTGCGACTTGTTACTCAAAATGTAATCAGTGCGAGCCTTGCATGCCAGTTCAAGTATCAGTCCGGGCAATGGAATTGGAAGAAAACGAGTACTATCCACTAGTCTGGAAATGTGCTTGTGGTGATAATATATTTTCCCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

11.96

Weight (kDa)

8.14

Isoelectric Point (pI)

85.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EPF PF17181 58 - 108 3.1e-20 Epidermal patterning factor proteins
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015531)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 275
AfiI CCNNNNNNNGG 3 cut(s) 119, 149, 253
AgsI TTSAA 2 cut(s) 160, 236
AhlI ACTAGT 1 cut(s) 283
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
AoxI GGCC 1 cut(s) 114
AspS9I GGNCC 2 cut(s) 37, 115
AsuC2I CCSGG 1 cut(s) 248
AsuHPI GGTGA 2 cut(s) 102, 317
AvaII GGWCC 1 cut(s) 37
BauI CACGAG 2 cut(s) 79, 137
BccI CCATC 1 cut(s) 151
BcnI CCSGG 1 cut(s) 248
BcuI ACTAGT 1 cut(s) 283
BfaI CTAG 1 cut(s) 284
BmcAI AGTACT 1 cut(s) 275
Bme1390I CCNGG 1 cut(s) 248
Bme18I GGWCC 1 cut(s) 37
BmgT120I GGNCC 2 cut(s) 37, 115
BmrFI CCNGG 1 cut(s) 248
BmsI GCATC 2 cut(s) 13, 114
BpuEI CTTGAG 1 cut(s) 76
BpuMI CCSGG 1 cut(s) 248
BsaJI CCNNGG 1 cut(s) 118
Bsc4I CCNNNNNNNGG 3 cut(s) 119, 149, 253
Bse118I RCCGGY 1 cut(s) 112
Bse1I ACTGG 1 cut(s) 230
Bse3DI GCAATG 1 cut(s) 258
BseDI CCNNGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 129
BseLI CCNNNNNNNGG 3 cut(s) 119, 149, 253
BseMI GCAATG 1 cut(s) 258
BseNI ACTGG 1 cut(s) 230
BshFI GGCC 1 cut(s) 116
BsiSI CCGG 2 cut(s) 113, 247
BslI CCNNNNNNNGG 3 cut(s) 119, 149, 253
BsnI GGCC 1 cut(s) 116
BspANI GGCC 1 cut(s) 116
BsrDI GCAATG 1 cut(s) 258
BsrFI RCCGGY 1 cut(s) 112
BsrI ACTGG 1 cut(s) 230
BssAI RCCGGY 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 118
BssSI CACGAG 2 cut(s) 79, 137
BssT1I CCWWGG 1 cut(s) 118
Bst2BI CACGAG 2 cut(s) 79, 137
BstC8I GCNNGC 2 cut(s) 218, 227
BstDEI CTNAG 1 cut(s) 324
BstF5I GGATG 1 cut(s) 129
BstMWI GCNNNNNNNGC 2 cut(s) 222, 226
BstNSI RCATGY 1 cut(s) 229
BstSCI CCNGG 1 cut(s) 246
BstXI CCANNNNNNTGG 1 cut(s) 288
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 218
Cac8I GCNNGC 2 cut(s) 218, 227
Cfr10I RCCGGY 1 cut(s) 112
Cfr13I GGNCC 2 cut(s) 37, 115
Csp6I GTAC 1 cut(s) 274
CviAII CATG 1 cut(s) 226
CviJI RGCY 5 cut(s) 69, 96, 116, 142, 220
CviKI_1 RGCY 5 cut(s) 69, 96, 116, 142, 220
CviQI GTAC 1 cut(s) 274
DdeI CTNAG 1 cut(s) 324
Eco130I CCWWGG 1 cut(s) 118
Eco47I GGWCC 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 118
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 118
FaeI CATG 1 cut(s) 229
FaiI YATR 2 cut(s) 227, 314
FalI AAGNNNNNCTT 2 cut(s) 85, 117
FatI CATG 1 cut(s) 225
FokI GGATG 1 cut(s) 136
FspBI CTAG 1 cut(s) 284
HaeIII GGCC 1 cut(s) 116
HapII CCGG 2 cut(s) 113, 247
Hin1II CATG 1 cut(s) 229
HpaII CCGG 2 cut(s) 113, 247
HphI GGTGA 2 cut(s) 102, 317
Hpy166II GTNNAC 1 cut(s) 76
Hpy188III TCNNGA 2 cut(s) 8, 289
Hpy8I GTNNAC 1 cut(s) 76
HpyAV CCTTC 2 cut(s) 111, 117
HpyCH4V TGCA 2 cut(s) 4, 225
HpyF10VI GCNNNNNNNGC 2 cut(s) 222, 226
HpyF3I CTNAG 1 cut(s) 324
Hsp92II CATG 1 cut(s) 229
LpnPI CCDG 6 cut(s) 51, 126, 198, 243, 260, 274
LweI GCATC 2 cut(s) 13, 114
MaeI CTAG 1 cut(s) 284
MaeIII GTNAC 1 cut(s) 194
MboII GAAGA 1 cut(s) 275
MluCI AATT 2 cut(s) 30, 257
MnlI CCTC 2 cut(s) 50, 167
Mph1103I ATGCAT 1 cut(s) 6
MspI CCGG 2 cut(s) 113, 247
MspR9I CCNGG 1 cut(s) 248
MwoI GCNNNNNNNGC 2 cut(s) 222, 226
NciI CCSGG 1 cut(s) 248
NlaIII CATG 1 cut(s) 229
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 229
PaeI GCATGC 1 cut(s) 229
PcsI WCGNNNNNNNCGW 1 cut(s) 77
PspPI GGNCC 2 cut(s) 37, 115
RsaI GTAC 1 cut(s) 275
RsaNI GTAC 1 cut(s) 274
Sau96I GGNCC 2 cut(s) 37, 115
ScaI AGTACT 1 cut(s) 275
ScrFI CCNGG 1 cut(s) 248
SetI ASST 1 cut(s) 98
SfaNI GCATC 2 cut(s) 13, 114
SinI GGWCC 1 cut(s) 37
SmlI CTYRAG 1 cut(s) 91
SmoI CTYRAG 1 cut(s) 91
SpeI ACTAGT 1 cut(s) 283
SphI GCATGC 1 cut(s) 229
Sse9I AATT 2 cut(s) 30, 257
SspMI CTAG 1 cut(s) 284
StyD4I CCNGG 1 cut(s) 246
StyI CCWWGG 1 cut(s) 118
TaqI TCGA 1 cut(s) 7
TasI AATT 2 cut(s) 30, 257
TatI WGTACW 1 cut(s) 273
TscAI CASTG 1 cut(s) 218
TspRI CASTG 1 cut(s) 218
VpaK11BI GGWCC 1 cut(s) 37
XceI RCATGY 1 cut(s) 229
XspI CTAG 1 cut(s) 284
ZrmI AGTACT 1 cut(s) 275
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.