Rh6BG522800

Guanine nucleotide-binding protein subunit gamma

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
71543517 .. 71543871
355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG522800.1

Sequence Viewer

Length: 246 bp
ATGGATAAGCAGCAAGAGGAAAACATATCATCTTCTCCAGGAAGATCAGGAGGAGGAGGAGCAAAGAGAGAAGATGCAGCAGCAACAGGCTCAGGAATCAGAGCAGGGCCGCCATGTCCGACTTTCGTAGGCAAGCATAGAATGGCTGCTGCTATTTCCCATCTCCATACTCAAATCAACATTATTCAGGAAGAGCTTAACGAGCTCGAAACAGTAGGCGAATCCTCCTTTGTCTGCAAAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

8.52

Weight (kDa)

5.55

Isoelectric Point (pI)

66.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014669)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 110
AjnI CCWGG 1 cut(s) 37
AluBI AGCT 2 cut(s) 196, 205
AluI AGCT 2 cut(s) 196, 205
Alw21I GWGCWC 1 cut(s) 207
AoxI GGCC 1 cut(s) 107
ApeKI GCWGC 5 cut(s) 10, 77, 80, 146, 149
AspS9I GGNCC 1 cut(s) 107
BanII GRGCYC 1 cut(s) 207
Bbv12I GWGCWC 1 cut(s) 207
BbvI GCAGC 5 cut(s) 22, 89, 92, 133, 136
BccI CCATC 1 cut(s) 168
BciT130I CCWGG 1 cut(s) 39
BisI GCNGC 6 cut(s) 11, 78, 81, 110, 147, 150
BlsI GCNGC 6 cut(s) 12, 79, 82, 111, 148, 151
Bme1390I CCNGG 1 cut(s) 39
BmgT120I GGNCC 1 cut(s) 107
BmrFI CCNGG 1 cut(s) 39
BmsI GCATC 1 cut(s) 64
BpmI CTGGAG 1 cut(s) 21
Bpu10I CCTNAGC 1 cut(s) 91
BseBI CCWGG 1 cut(s) 39
BseMII CTCAG 1 cut(s) 105
BseRI GAGGAG 3 cut(s) 66, 69, 72
BseXI GCAGC 5 cut(s) 22, 89, 92, 133, 136
BshFI GGCC 1 cut(s) 109
BsiHKAI GWGCWC 1 cut(s) 207
BsnI GGCC 1 cut(s) 109
Bsp1286I GDGCHC 1 cut(s) 207
Bsp143I GATC 1 cut(s) 44
BspACI CCGC 1 cut(s) 110
BspANI GGCC 1 cut(s) 109
BspCNI CTCAG 1 cut(s) 104
BspQI GCTCTTC 1 cut(s) 186
BssMI GATC 1 cut(s) 44
Bst2UI CCWGG 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 214
Bst6I CTCTTC 1 cut(s) 186
BstC8I GCNNGC 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 91
BstKTI GATC 1 cut(s) 47
BstMBI GATC 1 cut(s) 44
BstMWI GCNNNNNNNGC 1 cut(s) 202
BstNI CCWGG 1 cut(s) 39
BstSCI CCNGG 1 cut(s) 37
BstV1I GCAGC 5 cut(s) 22, 89, 92, 133, 136
BsuRI GGCC 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 134
Cfr13I GGNCC 1 cut(s) 107
CviAII CATG 1 cut(s) 114
CviJI RGCY 5 cut(s) 90, 109, 146, 196, 205
CviKI_1 RGCY 5 cut(s) 90, 109, 146, 196, 205
DdeI CTNAG 1 cut(s) 91
DpnI GATC 1 cut(s) 46
DpnII GATC 1 cut(s) 44
Eam1104I CTCTTC 1 cut(s) 186
EarI CTCTTC 1 cut(s) 186
Ecl136II GAGCTC 1 cut(s) 205
Eco24I GRGCYC 1 cut(s) 207
Eco53kI GAGCTC 1 cut(s) 205
EcoICRI GAGCTC 1 cut(s) 205
EcoRII CCWGG 1 cut(s) 37
EcoT38I GRGCYC 1 cut(s) 207
FaeI CATG 1 cut(s) 117
FaiI YATR 4 cut(s) 26, 115, 138, 168
FatI CATG 1 cut(s) 113
Fnu4HI GCNGC 6 cut(s) 11, 78, 81, 110, 147, 150
FriOI GRGCYC 1 cut(s) 207
Fsp4HI GCNGC 6 cut(s) 11, 78, 81, 110, 147, 150
GluI GCNGC 6 cut(s) 11, 78, 81, 110, 147, 150
GsuI CTGGAG 1 cut(s) 21
HaeIII GGCC 1 cut(s) 109
Hin1II CATG 1 cut(s) 117
HinfI GANTC 2 cut(s) 96, 221
Hpy188I TCNGA 2 cut(s) 101, 120
Hpy188III TCNNGA 3 cut(s) 48, 93, 188
HpyCH4III ACNGT 1 cut(s) 214
HpyCH4V TGCA 2 cut(s) 77, 237
HpyF10VI GCNNNNNNNGC 1 cut(s) 202
HpyF3I CTNAG 1 cut(s) 91
Hsp92II CATG 1 cut(s) 117
Kzo9I GATC 1 cut(s) 44
LguI GCTCTTC 1 cut(s) 186
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 7 cut(s) 24, 33, 51, 72, 78, 90, 173
Lsp1109I GCAGC 5 cut(s) 22, 89, 92, 133, 136
LweI GCATC 1 cut(s) 64
MalI GATC 1 cut(s) 46
MboI GATC 1 cut(s) 44
MboII GAAGA 4 cut(s) 24, 54, 83, 203
MhlI GDGCHC 1 cut(s) 207
MmeI TCCRAC 1 cut(s) 143
MnlI CCTC 5 cut(s) 10, 44, 47, 50, 235
MseI TTAA 1 cut(s) 198
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
MwoI GCNNNNNNNGC 1 cut(s) 202
NdeII GATC 1 cut(s) 44
NlaIII CATG 1 cut(s) 117
PciSI GCTCTTC 1 cut(s) 186
PfeI GAWTC 2 cut(s) 96, 221
PfoI TCCNGGA 1 cut(s) 37
PkrI GCNGC 6 cut(s) 12, 79, 82, 111, 148, 151
Psp124BI GAGCTC 1 cut(s) 207
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
PspPI GGNCC 1 cut(s) 107
SacI GAGCTC 1 cut(s) 207
SapI GCTCTTC 1 cut(s) 186
SaqAI TTAA 1 cut(s) 198
SatI GCNGC 6 cut(s) 11, 78, 81, 110, 147, 150
Sau3AI GATC 1 cut(s) 44
Sau96I GGNCC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 39
SduI GDGCHC 1 cut(s) 207
SetI ASST 2 cut(s) 198, 207
SfaNI GCATC 1 cut(s) 64
SsiI CCGC 1 cut(s) 110
SstI GAGCTC 1 cut(s) 207
StyD4I CCNGG 1 cut(s) 37
TaaI ACNGT 1 cut(s) 214
TaqI TCGA 1 cut(s) 207
TauI GCSGC 1 cut(s) 112
TfiI GAWTC 2 cut(s) 96, 221
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TseI GCWGC 5 cut(s) 10, 77, 80, 146, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.