Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6C

Orthogroup ID

OG0013908

Physical Location & Seq

Genomic Coordinates Forward (+)

66999668 .. 67004155

Gene Structure 4488 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6CG510300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

ATGGAGAAATGTGAGTTAGTGTTTGAAAGACAAAATTTTAAGCTTCTTACCACAACAAGAAAGACTACTACTGCAAAAAAGACTACTTCTGTGATTGATGAGATATTCGCCGGGAAAAAGAGGAAGAAAGCTGAAGCCGAAAAGGCTAAAAAGAAAAATGAAGAGGCGACTGGAAAATCCAACAGGCCCAAGAGAAAGAAGAAGAAAGATTTAGGCTTTGAAGACGGTGCATTTGTGGAGCCAAATTCTGGGTCAAAAAAGAGAACAAACGATGGCCTTGCTATCTATACAGAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1764

Protein Analysis

98

Amino Acids

11.13

Weight (kDa)

9.93

Isoelectric Point (pI)

25.2

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF1764	PF08576	24 - 98	2.1e-08	Eukaryotic protein of unknown function (DUF1764)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013908)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G11760
fragaria_vesca	FvH4_2g32140
malus_domestica	MD08G1044600.v1.1 MD15G1061800.v1.1
prunus_persica	Prupe.1G414500_v2.0.a1 Prupe.1G484700_v2.0.a1
pyrus_communis	pycom08g03590
rosa_chinensis	RchiOBHm_Chr6g0310541
rosa_multiflora	Rmu_sc0005386.1_g000001 Rmu_sc0016392.1_g000003 Rmu_sc0020729.1_g000001
rosa_roxburghii	Rroxscaffold_7G00158440
rosa_rugosa	Rorug06G0381400 Rorug06G0381500
rosa_samantha	Rh6AG495300 Rh6CG510300
rosa_wichuraiana	Rw6G043080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	248
AcsI	RAATTY	2 cut(s)	34, 244
AcuI	CTGAAG	1 cut(s)	153
AfiI	CCNNNNNNNGG	1 cut(s)	248
AgsI	TTSAA	2 cut(s)	26, 221
AluBI	AGCT	2 cut(s)	43, 131
AluI	AGCT	2 cut(s)	43, 131
AoxI	GGCC	2 cut(s)	185, 274
ApoI	RAATTY	2 cut(s)	34, 244
ArsI	GACNNNNNNTTYG	4 cut(s)	215, 236, 247, 268
AspS9I	GGNCC	1 cut(s)	186
AsuC2I	CCSGG	1 cut(s)	112
BbsI	GAAGAC	1 cut(s)	228
BccI	CCATC	1 cut(s)	266
BcgI	CGANNNNNNTGC	2 cut(s)	260, 294
BcnI	CCSGG	1 cut(s)	112
BglI	GCCNNNNNGGC	1 cut(s)	143
Bme1390I	CCNGG	1 cut(s)	112
BmgT120I	GGNCC	1 cut(s)	186
BmiI	GGNNCC	1 cut(s)	240
BmrFI	CCNGG	1 cut(s)	112
BpiI	GAAGAC	1 cut(s)	228
BpuMI	CCSGG	1 cut(s)	112
Bsc4I	CCNNNNNNNGG	1 cut(s)	248
Bse1I	ACTGG	1 cut(s)	175
BseLI	CCNNNNNNNGG	1 cut(s)	248
BseNI	ACTGG	1 cut(s)	175
BshFI	GGCC	2 cut(s)	187, 276
BsiSI	CCGG	1 cut(s)	111
BslI	CCNNNNNNNGG	1 cut(s)	248
BsnI	GGCC	2 cut(s)	187, 276
BspANI	GGCC	2 cut(s)	187, 276
BspLI	GGNNCC	1 cut(s)	240
BsrI	ACTGG	1 cut(s)	175
Bst4CI	ACNGT	1 cut(s)	227
Bst6I	CTCTTC	1 cut(s)	156
BstMWI	GCNNNNNNNGC	1 cut(s)	143
BstSCI	CCNGG	1 cut(s)	110
BstV2I	GAAGAC	1 cut(s)	228
BsuRI	GGCC	2 cut(s)	187, 276
Cfr13I	GGNCC	1 cut(s)	186
CviJI	RGCY	8 cut(s)	43, 131, 137, 146, 187, 216, 241, 276
CviKI_1	RGCY	8 cut(s)	43, 131, 137, 146, 187, 216, 241, 276
Eam1104I	CTCTTC	1 cut(s)	156
EarI	CTCTTC	1 cut(s)	156
Eco57I	CTGAAG	1 cut(s)	153
FaiI	YATR	1 cut(s)	288
HaeIII	GGCC	2 cut(s)	187, 276
HapII	CCGG	1 cut(s)	111
HindIII	AAGCTT	1 cut(s)	41
HpaII	CCGG	1 cut(s)	111
HpyCH4III	ACNGT	1 cut(s)	227
HpyCH4V	TGCA	2 cut(s)	74, 230
HpyF10VI	GCNNNNNNNGC	1 cut(s)	143
LmnI	GCTCC	1 cut(s)	238
LpnPI	CCDG	4 cut(s)	124, 156, 169, 234
MboII	GAAGA	5 cut(s)	136, 173, 211, 214, 233
MluCI	AATT	2 cut(s)	34, 244
MmeI	TCCRAC	1 cut(s)	204
MnlI	CCTC	2 cut(s)	114, 157
MseI	TTAA	1 cut(s)	39
MspI	CCGG	1 cut(s)	111
MspR9I	CCNGG	1 cut(s)	112
MwoI	GCNNNNNNNGC	1 cut(s)	143
NciI	CCSGG	1 cut(s)	112
NlaIV	GGNNCC	1 cut(s)	240
PflMI	CCANNNNNTGG	1 cut(s)	248
PspN4I	GGNNCC	1 cut(s)	240
PspPI	GGNCC	1 cut(s)	186
SaqAI	TTAA	1 cut(s)	39
Sau96I	GGNCC	1 cut(s)	186
ScrFI	CCNGG	1 cut(s)	112
SetI	ASST	2 cut(s)	45, 133
SgeI	CNNG	8 cut(s)	69, 123, 124, 183, 196, 202, 261, 290
Sse9I	AATT	2 cut(s)	34, 244
StyD4I	CCNGG	1 cut(s)	110
TaaI	ACNGT	1 cut(s)	227
TasI	AATT	2 cut(s)	34, 244
Tru1I	TTAA	1 cut(s)	39
Tru9I	TTAA	1 cut(s)	39
TspDTI	ATGAA	1 cut(s)	174
Van91I	CCANNNNNTGG	1 cut(s)	248
XapI	RAATTY	2 cut(s)	34, 244

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.