Rh7AG231000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
22147896 .. 22160565
12670 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG231000.1

Sequence Viewer

Length: 174 bp
ATGGTTTTCTCCATTGATTATCTAGAAGATGACCCAGCACGCACGACTTATAGACAGTCAATCCATCAAATACAAGAATTAGGGAGGTTTGAGCTCAACAGGGATAAACTAGTGGCTGTTAAAACTCAATTCAAGAAAGAAATAAATGAAGTCAAAGAAACCAGTTTGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.79

Weight (kDa)

5.71

Isoelectric Point (pI)

24.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 133
AhlI ACTAGT 1 cut(s) 109
AluBI AGCT 1 cut(s) 94
AluI AGCT 1 cut(s) 94
Alw21I GWGCWC 1 cut(s) 96
BanII GRGCYC 1 cut(s) 96
Bbv12I GWGCWC 1 cut(s) 96
BccI CCATC 1 cut(s) 72
BcuI ACTAGT 1 cut(s) 109
BfaI CTAG 2 cut(s) 23, 110
Bse1I ACTGG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 162
BseYI CCCAGC 1 cut(s) 34
BsiHKAI GWGCWC 1 cut(s) 96
Bsp1286I GDGCHC 1 cut(s) 96
BsrI ACTGG 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 57
BstC8I GCNNGC 1 cut(s) 40
Cac8I GCNNGC 1 cut(s) 40
CviJI RGCY 2 cut(s) 94, 116
CviKI_1 RGCY 2 cut(s) 94, 116
Ecl136II GAGCTC 1 cut(s) 94
Eco24I GRGCYC 1 cut(s) 96
Eco53kI GAGCTC 1 cut(s) 94
EcoICRI GAGCTC 1 cut(s) 94
EcoT38I GRGCYC 1 cut(s) 96
FaiI YATR 2 cut(s) 51, 172
FriOI GRGCYC 1 cut(s) 96
FspBI CTAG 2 cut(s) 23, 110
GsaI CCCAGC 1 cut(s) 38
Hpy188III TCNNGA 2 cut(s) 23, 133
HpyCH4III ACNGT 1 cut(s) 57
LpnPI CCDG 2 cut(s) 48, 85
MaeI CTAG 2 cut(s) 23, 110
MboII GAAGA 1 cut(s) 38
MhlI GDGCHC 1 cut(s) 96
MluCI AATT 2 cut(s) 77, 128
MnlI CCTC 1 cut(s) 78
MseI TTAA 1 cut(s) 120
Psp124BI GAGCTC 1 cut(s) 96
PspFI CCCAGC 1 cut(s) 34
SacI GAGCTC 1 cut(s) 96
SaqAI TTAA 1 cut(s) 120
SduI GDGCHC 1 cut(s) 96
SetI ASST 2 cut(s) 89, 96
SgeI CNNG 8 cut(s) 35, 47, 51, 55, 86, 112, 122, 145
SpeI ACTAGT 1 cut(s) 109
Sse9I AATT 2 cut(s) 77, 128
SspMI CTAG 2 cut(s) 23, 110
SstI GAGCTC 1 cut(s) 96
TaaI ACNGT 1 cut(s) 57
TasI AATT 2 cut(s) 77, 128
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 162
XbaI TCTAGA 1 cut(s) 22
XspI CTAG 2 cut(s) 23, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.