Rh7CG350800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
39862277 .. 39864509
2233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG350800.1

Sequence Viewer

Length: 303 bp
ATGAAGCGTGTATCTTTCAACGGAAATAATGAATTCTATAAGTCTAATCATTATGATTATGATGTCCCAGCTGACAACATTCTTGACACTTGTAGTGTCCGCTCTTTTAAAAGTTACACAGAATTACCAGATGCAGATGAGAATGTTTTCTTCACTAGATATACATACGACCATGTGGCTAAGAAGGTTGAAGATGCAAATGTTGATGTAAAAACTCAGGTCTCATCAAGATTCTGGCAAATCGTCAAGCCGGAGATCATATGTTGCGATGTGTTCGAAATTACAGAAGGTAAGTATTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.8

Weight (kDa)

4.89

Isoelectric Point (pI)

45.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BAH PF01426 7 - 64 2.4e-06 BAH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 102
AciI CCGC 1 cut(s) 100
AcsI RAATTY 1 cut(s) 32
AgsI TTSAA 2 cut(s) 19, 191
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw26I GTCTC 1 cut(s) 226
ApoI RAATTY 1 cut(s) 32
Asp700I GAANNNNTTC 1 cut(s) 146
AsuII TTCGAA 1 cut(s) 276
BcoDI GTCTC 1 cut(s) 226
BfaI CTAG 1 cut(s) 156
BmsI GCATC 2 cut(s) 121, 184
Bpu14I TTCGAA 1 cut(s) 276
BsaI GGTCTC 1 cut(s) 226
BseMII CTCAG 1 cut(s) 230
BseYI CCCAGC 1 cut(s) 67
BsiSI CCGG 1 cut(s) 251
BslFI GGGAC 1 cut(s) 50
BsmAI GTCTC 1 cut(s) 226
BsmFI GGGAC 1 cut(s) 50
Bso31I GGTCTC 1 cut(s) 226
Bsp119I TTCGAA 1 cut(s) 276
Bsp143I GATC 1 cut(s) 255
BspACI CCGC 1 cut(s) 100
BspCNI CTCAG 1 cut(s) 229
BspT104I TTCGAA 1 cut(s) 276
BspTNI GGTCTC 1 cut(s) 226
BsrBI CCGCTC 1 cut(s) 102
BssMI GATC 1 cut(s) 255
BstBI TTCGAA 1 cut(s) 276
BstDEI CTNAG 2 cut(s) 180, 216
BstKTI GATC 1 cut(s) 258
BstMAI GTCTC 1 cut(s) 226
BstMBI GATC 1 cut(s) 255
BtgZI GCGATG 1 cut(s) 282
CviAII CATG 1 cut(s) 173
CviJI RGCY 3 cut(s) 71, 179, 250
CviKI_1 RGCY 3 cut(s) 71, 179, 250
DdeI CTNAG 2 cut(s) 180, 216
DpnI GATC 1 cut(s) 257
DpnII GATC 1 cut(s) 255
DraI TTTAAA 1 cut(s) 109
Eco31I GGTCTC 1 cut(s) 226
EcoRI GAATTC 1 cut(s) 32
FaeI CATG 1 cut(s) 176
FaiI YATR 8 cut(s) 39, 54, 60, 162, 166, 174, 260, 262
FaqI GGGAC 1 cut(s) 50
FatI CATG 1 cut(s) 172
FauNDI CATATG 1 cut(s) 260
FspBI CTAG 1 cut(s) 156
GsaI CCCAGC 1 cut(s) 71
HapII CCGG 1 cut(s) 251
Hin1II CATG 1 cut(s) 176
HinfI GANTC 1 cut(s) 231
HpaII CCGG 1 cut(s) 251
Hpy188III TCNNGA 2 cut(s) 83, 228
HpyAV CCTTC 2 cut(s) 178, 281
HpyCH4V TGCA 2 cut(s) 134, 197
HpyF3I CTNAG 2 cut(s) 180, 216
Hsp92II CATG 1 cut(s) 176
Kzo9I GATC 1 cut(s) 255
LpnPI CCDG 5 cut(s) 81, 141, 203, 220, 264
LweI GCATC 2 cut(s) 121, 184
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 257
MbiI CCGCTC 1 cut(s) 102
MboI GATC 1 cut(s) 255
MboII GAAGA 2 cut(s) 142, 203
MluCI AATT 3 cut(s) 32, 122, 279
MroXI GAANNNNTTC 1 cut(s) 146
MseI TTAA 1 cut(s) 108
MspA1I CMGCKG 1 cut(s) 71
MspI CCGG 1 cut(s) 251
NdeI CATATG 1 cut(s) 260
NdeII GATC 1 cut(s) 255
NlaIII CATG 1 cut(s) 176
NspV TTCGAA 1 cut(s) 276
PdmI GAANNNNTTC 1 cut(s) 146
PfeI GAWTC 1 cut(s) 231
PspFI CCCAGC 1 cut(s) 67
PvuII CAGCTG 1 cut(s) 71
SaqAI TTAA 1 cut(s) 108
Sau3AI GATC 1 cut(s) 255
SetI ASST 4 cut(s) 73, 189, 222, 292
SfaNI GCATC 2 cut(s) 121, 184
SfuI TTCGAA 1 cut(s) 276
Sse9I AATT 3 cut(s) 32, 122, 279
SsiI CCGC 1 cut(s) 100
SspMI CTAG 1 cut(s) 156
TaqI TCGA 1 cut(s) 276
TasI AATT 3 cut(s) 32, 122, 279
TfiI GAWTC 1 cut(s) 231
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TspDTI ATGAA 2 cut(s) 17, 45
TspGWI ACGGA 1 cut(s) 36
XapI RAATTY 1 cut(s) 32
XmnI GAANNNNTTC 1 cut(s) 146
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.