Rh7DG044500

The light-harvesting complex (LHC) functions as a light receptor, it captures and delivers excitation energy to photosystems with which it is closely associated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0014422
Physical Location & Seq
Reverse (-)
3375801 .. 3377129
1329 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG044500.1

Sequence Viewer

Length: 684 bp
ATGGCAACCGTCACGACTCAGGCGTCCGCCGTCTACAGGCCACAAATCACCTCGAAATCGAGGTTCCTTACCGGCTCTTCCGGCAAGTTAACTAGGGAAGTGGCTTTTAGGCCTGTGACATCATCTGCTAGTTCTTTTAAAGTCGAGGCCAAGAAGGGTGAGTGGTTGCCTGGCTTGCCATCACCAGGTTACCTAACTGGCAGTCTTCCTGGTGACAATGGGTTTGATCCTTTGGCACTTGCTGAGGACCCAGAGAACCTGAGGTGGTATGTCCAAGCTGAGCTTGTGAACGGTCGTTGGGCTATGTTGGGTGTAGTTGGGATGCTATTGCCTGAAGTCTTGACAAGCATTGGGATCATTAACGTTCCGAAATGGTACGATGCTGGGAAAGCCGAGTACTTTGCATCTTCCTCCACCCTCTTTGTGATCGAGTTCATCTTGTTCCACTATGTCGAGATCAGACGGTGGCAAGACATCAAGAACCCAGGAAGTGTGAACCAAGACCCCATCTTCAAGCAATACAGCTTGCCACCAAATGAGGTAGGTTACCCTGGTGGCATCTTCAACCCTCTCAACTTTGCACCAACTGAGGAGGCCAAGGAGAAGGAACTCGCCAACGGTAAGTCTTTGAGAATCAGCCTCAAGCTCGTTTTTGATCAGATGACTTTTGTGGGTTTCAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00196 map00196
Pfam Domains
Protein Families
Chloroa_b-bind

Protein Analysis

227

Amino Acids

25.1

Weight (kDa)

6.62

Isoelectric Point (pI)

42.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Chloroa_b-bind PF00504 62 - 207 2.4e-37 Chlorophyll A-B binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014422)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G47470
fragaria_vesca FvH4_5g14770
malus_domestica MD06G1195000.v1.1 MD14G1202000.v1.1
prunus_persica Prupe.5G195100_v2.0.a1
pyrus_communis pycom06g17250 pycom14g16730
rosa_chinensis RchiOBHm_Chr7g0181611
rosa_laevigata RLG00000005179
rosa_multiflora Rmu_sc0000988.1_g000017
rosa_roxburghii Rroxscaffold_3G00271850
rosa_rugosa Rorug06G0442500
rosa_samantha Rh7AG044900 Rh7BG043900 Rh7CG045600 Rh7DG044500
rosa_wichuraiana Rw7G003730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 22
AccI GTMKAC 1 cut(s) 33
AciI CCGC 1 cut(s) 27
AclI AACGTT 1 cut(s) 363
AclWI GGATC 2 cut(s) 221, 362
AcuI CTGAAG 1 cut(s) 354
AcyI GRCGYC 1 cut(s) 23
AfaI GTAC 2 cut(s) 377, 398
AfiI CCNNNNNNNGG 2 cut(s) 36, 185
AgsI TTSAA 3 cut(s) 514, 565, 679
AjnI CCWGG 5 cut(s) 169, 184, 208, 484, 550
AluBI AGCT 4 cut(s) 278, 283, 525, 646
AluI AGCT 4 cut(s) 278, 283, 525, 646
AlwI GGATC 2 cut(s) 221, 362
AoxI GGCC 4 cut(s) 38, 110, 147, 594
ArsI GACNNNNNNTTYG 2 cut(s) 206, 238
AspS9I GGNCC 1 cut(s) 247
AsuHPI GGTGA 4 cut(s) 40, 170, 174, 224
AvaII GGWCC 1 cut(s) 247
AxyI CCTNAGG 1 cut(s) 260
BbsI GAAGAC 1 cut(s) 197
BbvCI CCTCAGC 1 cut(s) 243
BccI CCATC 2 cut(s) 187, 515
BceAI ACGGC 1 cut(s) 14
BcgI CGANNNNNNTGC 2 cut(s) 383, 417
BciT130I CCWGG 5 cut(s) 171, 186, 210, 486, 552
BclI TGATCA 1 cut(s) 655
BfaI CTAG 2 cut(s) 93, 129
BfmI CTRYAG 1 cut(s) 34
BlpI GCTNAGC 1 cut(s) 279
BmcAI AGTACT 1 cut(s) 398
Bme1390I CCNGG 5 cut(s) 171, 186, 210, 486, 552
Bme18I GGWCC 1 cut(s) 247
BmgT120I GGNCC 1 cut(s) 247
BmiI GGNNCC 2 cut(s) 65, 249
BmrFI CCNGG 5 cut(s) 171, 186, 210, 486, 552
BmsI GCATC 4 cut(s) 312, 370, 413, 567
BpiI GAAGAC 1 cut(s) 197
Bpu10I CCTNAGC 1 cut(s) 243
Bpu1102I GCTNAGC 1 cut(s) 279
BpuEI CTTGAG 1 cut(s) 626
BsaHI GRCGYC 1 cut(s) 23
BsaJI CCNNGG 3 cut(s) 484, 550, 597
Bsc4I CCNNNNNNNGG 2 cut(s) 36, 185
Bse118I RCCGGY 1 cut(s) 71
Bse1I ACTGG 1 cut(s) 202
Bse21I CCTNAGG 1 cut(s) 260
BseBI CCWGG 5 cut(s) 171, 186, 210, 486, 552
BseDI CCNNGG 3 cut(s) 484, 550, 597
BseGI GGATG 1 cut(s) 327
BseLI CCNNNNNNNGG 2 cut(s) 36, 185
BseMII CTCAG 5 cut(s) 32, 234, 251, 270, 579
BseNI ACTGG 1 cut(s) 202
BseRI GAGGAG 1 cut(s) 605
BseYI CCCAGC 1 cut(s) 383
Bsh1285I CGRYCG 1 cut(s) 295
BshFI GGCC 4 cut(s) 40, 112, 149, 596
BsiEI CGRYCG 1 cut(s) 295
BsiSI CCGG 2 cut(s) 72, 81
BslI CCNNNNNNNGG 2 cut(s) 36, 185
BsnI GGCC 4 cut(s) 40, 112, 149, 596
Bsp143I GATC 5 cut(s) 226, 354, 426, 456, 655
Bsp1720I GCTNAGC 1 cut(s) 279
BspACI CCGC 1 cut(s) 27
BspANI GGCC 4 cut(s) 40, 112, 149, 596
BspCNI CTCAG 5 cut(s) 31, 235, 252, 271, 580
BspLI GGNNCC 2 cut(s) 65, 249
BspPI GGATC 2 cut(s) 221, 362
BspQI GCTCTTC 1 cut(s) 82
BsrFI RCCGGY 1 cut(s) 71
BsrI ACTGG 1 cut(s) 202
BssAI RCCGGY 1 cut(s) 71
BssECI CCNNGG 3 cut(s) 484, 550, 597
BssMI GATC 5 cut(s) 226, 354, 426, 456, 655
BssNI GRCGYC 1 cut(s) 23
BssT1I CCWWGG 1 cut(s) 597
Bst2UI CCWGG 5 cut(s) 171, 186, 210, 486, 552
Bst4CI ACNGT 4 cut(s) 10, 293, 465, 620
Bst6I CTCTTC 1 cut(s) 82
BstACI GRCGYC 1 cut(s) 23
BstC8I GCNNGC 2 cut(s) 176, 527
BstDEI CTNAG 5 cut(s) 18, 243, 260, 279, 588
BstEII GGTNACC 2 cut(s) 188, 545
BstF5I GGATG 1 cut(s) 327
BstKTI GATC 5 cut(s) 229, 357, 429, 459, 658
BstMBI GATC 5 cut(s) 226, 354, 426, 456, 655
BstMCI CGRYCG 1 cut(s) 295
BstMWI GCNNNNNNNGC 3 cut(s) 81, 175, 389
BstNI CCWGG 5 cut(s) 171, 186, 210, 486, 552
BstPI GGTNACC 2 cut(s) 188, 545
BstSCI CCNGG 5 cut(s) 169, 184, 208, 484, 550
BstSFI CTRYAG 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 197
Bsu36I CCTNAGG 1 cut(s) 260
BsuRI GGCC 4 cut(s) 40, 112, 149, 596
BtsCI GGATG 1 cut(s) 327
Cac8I GCNNGC 2 cut(s) 176, 527
Cfr10I RCCGGY 1 cut(s) 71
Cfr13I GGNCC 1 cut(s) 247
CseI GACGC 1 cut(s) 12
CsiI ACCWGGT 1 cut(s) 184
Csp6I GTAC 2 cut(s) 376, 397
CspCI CAANNNNNGTGG 2 cut(s) 403, 438
CviQI GTAC 2 cut(s) 376, 397
DdeI CTNAG 5 cut(s) 18, 243, 260, 279, 588
DpnI GATC 5 cut(s) 228, 356, 428, 458, 657
DpnII GATC 5 cut(s) 226, 354, 426, 456, 655
DraI TTTAAA 1 cut(s) 139
DrdI GACNNNNNNGTC 1 cut(s) 22
DseDI GACNNNNNNGTC 1 cut(s) 22
Eam1104I CTCTTC 1 cut(s) 82
EarI CTCTTC 1 cut(s) 82
EciI GGCGGA 1 cut(s) 16
Eco130I CCWWGG 1 cut(s) 597
Eco147I AGGCCT 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 247
Eco57I CTGAAG 1 cut(s) 354
Eco81I CCTNAGG 1 cut(s) 260
Eco91I GGTNACC 2 cut(s) 188, 545
EcoO109I RGGNCCY 1 cut(s) 247
EcoO65I GGTNACC 2 cut(s) 188, 545
EcoRII CCWGG 5 cut(s) 169, 184, 208, 484, 550
EcoT14I CCWWGG 1 cut(s) 597
ErhI CCWWGG 1 cut(s) 597
FaiI YATR 3 cut(s) 270, 305, 450
FalI AAGNNNNNCTT 2 cut(s) 267, 299
FbaI TGATCA 1 cut(s) 655
FblI GTMKAC 1 cut(s) 33
FokI GGATG 1 cut(s) 334
FspBI CTAG 2 cut(s) 93, 129
GsaI CCCAGC 1 cut(s) 387
HaeIII GGCC 4 cut(s) 40, 112, 149, 596
HapII CCGG 2 cut(s) 72, 81
HgaI GACGC 1 cut(s) 12
Hin1I GRCGYC 1 cut(s) 23
HincII GTYRAC 1 cut(s) 90
HindII GTYRAC 1 cut(s) 90
HinfI GANTC 2 cut(s) 16, 633
HpaI GTTAAC 1 cut(s) 90
HpaII CCGG 2 cut(s) 72, 81
HphI GGTGA 4 cut(s) 40, 170, 174, 224
Hpy166II GTNNAC 4 cut(s) 34, 90, 289, 496
Hpy188I TCNGA 3 cut(s) 369, 461, 660
Hpy188III TCNNGA 4 cut(s) 13, 340, 454, 478
Hpy8I GTNNAC 4 cut(s) 34, 90, 289, 496
HpyAV CCTTC 2 cut(s) 148, 598
HpyCH4III ACNGT 4 cut(s) 10, 293, 465, 620
HpyCH4IV ACGT 1 cut(s) 363
HpyCH4V TGCA 2 cut(s) 404, 581
HpyF10VI GCNNNNNNNGC 3 cut(s) 81, 175, 389
HpyF3I CTNAG 5 cut(s) 18, 243, 260, 279, 588
HpySE526I ACGT 1 cut(s) 363
Hsp92I GRCGYC 1 cut(s) 23
Ksp22I TGATCA 1 cut(s) 655
KspAI GTTAAC 1 cut(s) 90
Kzo9I GATC 5 cut(s) 226, 354, 426, 456, 655
LguI GCTCTTC 1 cut(s) 82
LweI GCATC 4 cut(s) 312, 370, 413, 567
MabI ACCWGGT 1 cut(s) 184
MaeI CTAG 2 cut(s) 93, 129
MaeII ACGT 1 cut(s) 363
MaeIII GTNAC 5 cut(s) 10, 115, 188, 212, 545
MalI GATC 5 cut(s) 228, 356, 428, 458, 657
MboI GATC 5 cut(s) 226, 354, 426, 456, 655
MboII GAAGA 5 cut(s) 69, 197, 399, 502, 553
MlyI GAGTC 1 cut(s) 10
MseI TTAA 3 cut(s) 89, 138, 360
MspI CCGG 2 cut(s) 72, 81
MspR9I CCNGG 5 cut(s) 171, 186, 210, 486, 552
MvaI CCWGG 5 cut(s) 171, 186, 210, 486, 552
MwoI GCNNNNNNNGC 3 cut(s) 81, 175, 389
NdeII GATC 5 cut(s) 226, 354, 426, 456, 655
NlaIV GGNNCC 2 cut(s) 65, 249
NmeAIII GCCGAG 1 cut(s) 418
NmuCI GTSAC 3 cut(s) 10, 115, 212
PceI AGGCCT 1 cut(s) 112
PciSI GCTCTTC 1 cut(s) 82
PcsI WCGNNNNNNNCGW 1 cut(s) 20
PfeI GAWTC 1 cut(s) 633
PleI GAGTC 1 cut(s) 10
PpsI GAGTC 1 cut(s) 10
PpuMI RGGWCCY 1 cut(s) 247
Psp1406I AACGTT 1 cut(s) 363
Psp5II RGGWCCY 1 cut(s) 247
Psp6I CCWGG 5 cut(s) 169, 184, 208, 484, 550
PspEI GGTNACC 2 cut(s) 188, 545
PspFI CCCAGC 1 cut(s) 383
PspGI CCWGG 5 cut(s) 169, 184, 208, 484, 550
PspN4I GGNNCC 2 cut(s) 65, 249
PspPI GGNCC 1 cut(s) 247
PspPPI RGGWCCY 1 cut(s) 247
RsaI GTAC 2 cut(s) 377, 398
RsaNI GTAC 2 cut(s) 376, 397
SapI GCTCTTC 1 cut(s) 82
SaqAI TTAA 3 cut(s) 89, 138, 360
Sau3AI GATC 5 cut(s) 226, 354, 426, 456, 655
Sau96I GGNCC 1 cut(s) 247
ScaI AGTACT 1 cut(s) 398
SchI GAGTC 1 cut(s) 10
ScrFI CCNGG 5 cut(s) 171, 186, 210, 486, 552
SexAI ACCWGGT 1 cut(s) 184
SfaNI GCATC 4 cut(s) 312, 370, 413, 567
SfcI CTRYAG 1 cut(s) 34
SinI GGWCC 1 cut(s) 247
SmlI CTYRAG 1 cut(s) 641
SmoI CTYRAG 1 cut(s) 641
SseBI AGGCCT 1 cut(s) 112
SsiI CCGC 1 cut(s) 27
SspMI CTAG 2 cut(s) 93, 129
StuI AGGCCT 1 cut(s) 112
StyD4I CCNGG 5 cut(s) 169, 184, 208, 484, 550
StyI CCWWGG 1 cut(s) 597
TaaI ACNGT 4 cut(s) 10, 293, 465, 620
TaiI ACGT 1 cut(s) 366
TaqI TCGA 5 cut(s) 53, 59, 144, 429, 453
TatI WGTACW 1 cut(s) 396
TfiI GAWTC 1 cut(s) 633
Tru1I TTAA 3 cut(s) 89, 138, 360
Tru9I TTAA 3 cut(s) 89, 138, 360
TseFI GTSAC 3 cut(s) 10, 115, 212
Tsp45I GTSAC 3 cut(s) 10, 115, 212
TspDTI ATGAA 1 cut(s) 424
VpaK11BI GGWCC 1 cut(s) 247
XmiI GTMKAC 1 cut(s) 33
XspI CTAG 2 cut(s) 93, 129
ZrmI AGTACT 1 cut(s) 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.