Rw1G008900

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
19556434 .. 19557370
937 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G008900.1

Sequence Viewer

Length: 273 bp
ATGGTCAGGAATTCTCGTCGTCTCCTTCTGACTTGTGAAAAAGAGAGCGTCACTCTGAGAGAGTGTTCTCACCAGAGCAAGAACGACTGCTTTGTCAGGCTCAAACACCCAAATATTCGTATTCCAAGAGGCGTTAGAGGCCGAAATTATCTTCTGATAGAAATTTTTGGGATAGATCTGTCAACTCTGAAAGTATGCGAAACGAAGCTGCACAGAAGAGATCGGGTTCTACCTCTGCAGTTGTTGATTACAGTGACCCATTTGCCATACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.62

Weight (kDa)

10.15

Isoelectric Point (pI)

50.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018957)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0330471
rosa_laevigata RLG00000029807 RLG00000029808
rosa_multiflora Rmu_sc0000815.1_g000008
rosa_samantha Rh1AG107200 Rh1BG085400 Rh1CG103100 Rh1DG112800
rosa_wichuraiana Rw1G008900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 92
AcsI RAATTY 2 cut(s) 10, 162
AluBI AGCT 1 cut(s) 208
AluI AGCT 1 cut(s) 208
Alw26I GTCTC 1 cut(s) 26
AoxI GGCC 1 cut(s) 139
ApeKI GCWGC 1 cut(s) 208
ApoI RAATTY 2 cut(s) 10, 162
AsuHPI GGTGA 1 cut(s) 62
BbvI GCAGC 1 cut(s) 195
BcoDI GTCTC 1 cut(s) 26
BfmI CTRYAG 1 cut(s) 236
BglII AGATCT 1 cut(s) 175
BisI GCNGC 1 cut(s) 209
BlsI GCNGC 1 cut(s) 210
BplI GAGNNNNNCTC 2 cut(s) 37, 69
BseMII CTCAG 1 cut(s) 47
BseXI GCAGC 1 cut(s) 195
BsgI GTGCAG 1 cut(s) 194
BshFI GGCC 1 cut(s) 141
BsmAI GTCTC 1 cut(s) 26
BsmBI CGTCTC 1 cut(s) 26
BsnI GGCC 1 cut(s) 141
Bsp143I GATC 2 cut(s) 175, 220
BspANI GGCC 1 cut(s) 141
BspCNI CTCAG 1 cut(s) 48
BspMAI CTGCAG 1 cut(s) 240
BssMI GATC 2 cut(s) 175, 220
Bst4CI ACNGT 1 cut(s) 253
Bst6I CTCTTC 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 56
BstKTI GATC 2 cut(s) 178, 223
BstMAI GTCTC 1 cut(s) 26
BstMBI GATC 2 cut(s) 175, 220
BstMWI GCNNNNNNNGC 1 cut(s) 138
BstSFI CTRYAG 1 cut(s) 236
BstV1I GCAGC 1 cut(s) 195
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
BsuRI GGCC 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 258
CseI GACGC 1 cut(s) 37
CviJI RGCY 3 cut(s) 100, 141, 208
CviKI_1 RGCY 3 cut(s) 100, 141, 208
DdeI CTNAG 1 cut(s) 56
DpnI GATC 2 cut(s) 177, 222
DpnII GATC 2 cut(s) 175, 220
DrdI GACNNNNNNGTC 1 cut(s) 92
DseDI GACNNNNNNGTC 1 cut(s) 92
Eam1104I CTCTTC 1 cut(s) 211
EarI CTCTTC 1 cut(s) 211
EcoRI GAATTC 1 cut(s) 10
Esp3I CGTCTC 1 cut(s) 26
FaiI YATR 2 cut(s) 196, 268
Fnu4HI GCNGC 1 cut(s) 209
Fsp4HI GCNGC 1 cut(s) 209
GluI GCNGC 1 cut(s) 209
HaeIII GGCC 1 cut(s) 141
HgaI GACGC 1 cut(s) 37
HincII GTYRAC 1 cut(s) 183
HindII GTYRAC 1 cut(s) 183
HphI GGTGA 1 cut(s) 62
Hpy166II GTNNAC 1 cut(s) 183
Hpy188I TCNGA 4 cut(s) 30, 57, 156, 189
Hpy188III TCNNGA 1 cut(s) 7
Hpy8I GTNNAC 1 cut(s) 183
Hpy99I CGWCG 1 cut(s) 21
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 253
HpyCH4V TGCA 2 cut(s) 211, 238
HpyF10VI GCNNNNNNNGC 1 cut(s) 138
HpyF3I CTNAG 1 cut(s) 56
Kzo9I GATC 2 cut(s) 175, 220
LpnPI CCDG 2 cut(s) 82, 86
Lsp1109I GCAGC 1 cut(s) 195
MaeIII GTNAC 2 cut(s) 49, 253
MalI GATC 2 cut(s) 177, 222
MboI GATC 2 cut(s) 175, 220
MboII GAAGA 2 cut(s) 143, 228
MflI RGATCY 1 cut(s) 175
MluCI AATT 3 cut(s) 10, 145, 162
MnlI CCTC 3 cut(s) 122, 131, 243
MwoI GCNNNNNNNGC 1 cut(s) 138
NdeII GATC 2 cut(s) 175, 220
NmuCI GTSAC 2 cut(s) 49, 253
PkrI GCNGC 1 cut(s) 210
PstI CTGCAG 1 cut(s) 240
PsuI RGATCY 1 cut(s) 175
SatI GCNGC 1 cut(s) 209
Sau3AI GATC 2 cut(s) 175, 220
SetI ASST 2 cut(s) 210, 235
SfcI CTRYAG 1 cut(s) 236
SgeI CNNG 8 cut(s) 19, 27, 45, 85, 91, 109, 138, 236
Sse9I AATT 3 cut(s) 10, 145, 162
SspI AATATT 1 cut(s) 115
TaaI ACNGT 1 cut(s) 253
TasI AATT 3 cut(s) 10, 145, 162
TscAI CASTG 1 cut(s) 258
TseFI GTSAC 2 cut(s) 49, 253
TseI GCWGC 1 cut(s) 208
Tsp45I GTSAC 2 cut(s) 49, 253
TspRI CASTG 1 cut(s) 258
XapI RAATTY 2 cut(s) 10, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.