Rw2G018870

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
OG0015524
Physical Location & Seq
Reverse (-)
24815495 .. 24818869
3375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G018870.1

Sequence Viewer

Length: 795 bp
ATGTCCATGTGCTTATCCAAGCAAGACTTTCTAGCAAAGGATATTAAACTTGGACAAGAAGATTTAGCATGTGCTACCTATGGATGCTCAGAGTCAACATTGGTGTGTCTAAGACAAAAAAGAAAAAACAAACAAACAGTGAAGACATCAGACAGCTTTGGTTGCTTTAACTTCTTCAAGTGCGTAGCAGTCTATCTTTGCATTAATGCTGACGGTTATGCTAACATGACCAAAGAAGTTGCTGTTAATGTGGCCTTTGAAGCTCTATTGCAAGGAAGTTTGAAAGATTATTGCTCCAGTGGAATTCTGAGGGTGACATACGTGCATAAAGATGGTTGCATTTTTATTACGTATCGGGTTCTAGATGTCTACAAAACACTATACAAAACATTGTATGACTCAGCAGACAAGGAAGAACAAGCTACTTTGTTCTTGCTATATTCTACAAGTTTTGGTCCTATTTTCGGAGGAGATAATATACAAGCACTCATAAGCGACATCTGGTCAGGAGGACTAAAGAGTATTATCCATTCTAATATCATCGCAAAAAAGGCTTGCTTTTATGTTCATCGTATAGTGCTCAAAGATGAAAATGAGGCTATAAAAGCATACGATGACATAAGCACTAAAAATGCTAGGCCCATTTATCCTCAGGCTTTAGCTCATATTCGAAGCTACTTAATTGATTGTGTAAGAGAAAAAACTAGAGAGCATGTTTACATTGGAAGGAGCTCCAAGGAGTTGTTAGAAGGCATATGCATGTTGAAGGATGCAGATACTTTAAAGTATCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

264

Amino Acids

29.8

Weight (kDa)

8.35

Isoelectric Point (pI)

40.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 369
AcsI RAATTY 1 cut(s) 303
AfiI CCNNNNNNNGG 1 cut(s) 464
AgsI TTSAA 4 cut(s) 178, 260, 283, 766
AhdI GACNNNNNGTC 1 cut(s) 502
AluBI AGCT 6 cut(s) 156, 263, 422, 662, 675, 732
AluI AGCT 6 cut(s) 156, 263, 422, 662, 675, 732
Alw21I GWGCWC 2 cut(s) 582, 734
AoxI GGCC 2 cut(s) 252, 638
ApoI RAATTY 1 cut(s) 303
AseI ATTAAT 1 cut(s) 204
AspS9I GGNCC 2 cut(s) 455, 639
AsuHPI GGTGA 1 cut(s) 325
AsuII TTCGAA 1 cut(s) 670
AvaII GGWCC 1 cut(s) 455
AxyI CCTNAGG 1 cut(s) 651
BanII GRGCYC 1 cut(s) 734
BbsI GAAGAC 1 cut(s) 149
Bbv12I GWGCWC 2 cut(s) 582, 734
BccI CCATC 1 cut(s) 326
BfaI CTAG 4 cut(s) 32, 362, 636, 705
Bme18I GGWCC 1 cut(s) 455
BmeRI GACNNNNNGTC 1 cut(s) 502
BmgT120I GGNCC 2 cut(s) 455, 639
BmsI GCATC 2 cut(s) 74, 760
BpiI GAAGAC 1 cut(s) 149
BpmI CTGGAG 1 cut(s) 280
Bpu14I TTCGAA 1 cut(s) 670
BsaAI YACGTR 2 cut(s) 322, 351
BsaJI CCNNGG 1 cut(s) 735
Bsc4I CCNNNNNNNGG 1 cut(s) 464
Bse1I ACTGG 1 cut(s) 297
Bse21I CCTNAGG 1 cut(s) 651
BseDI CCNNGG 1 cut(s) 735
BseGI GGATG 2 cut(s) 89, 775
BseLI CCNNNNNNNGG 1 cut(s) 464
BseMII CTCAG 4 cut(s) 102, 299, 414, 665
BseNI ACTGG 1 cut(s) 297
BseRI GAGGAG 1 cut(s) 483
BshFI GGCC 2 cut(s) 254, 640
BsiHKAI GWGCWC 2 cut(s) 582, 734
BslI CCNNNNNNNGG 1 cut(s) 464
BsnI GGCC 2 cut(s) 254, 640
Bsp119I TTCGAA 1 cut(s) 670
Bsp1286I GDGCHC 2 cut(s) 582, 734
BspANI GGCC 2 cut(s) 254, 640
BspCNI CTCAG 4 cut(s) 101, 300, 413, 664
BspT104I TTCGAA 1 cut(s) 670
BsrI ACTGG 1 cut(s) 297
BssECI CCNNGG 1 cut(s) 735
BssT1I CCWWGG 1 cut(s) 735
Bst4CI ACNGT 2 cut(s) 139, 215
BstBAI YACGTR 2 cut(s) 322, 351
BstBI TTCGAA 1 cut(s) 670
BstC8I GCNNGC 1 cut(s) 556
BstDEI CTNAG 5 cut(s) 88, 110, 308, 400, 651
BstF5I GGATG 2 cut(s) 89, 775
BstMWI GCNNNNNNNGC 4 cut(s) 162, 260, 551, 605
BstNSI RCATGY 3 cut(s) 72, 716, 763
BstSNI TACGTA 1 cut(s) 351
BstV2I GAAGAC 1 cut(s) 149
Bsu36I CCTNAGG 1 cut(s) 651
BsuRI GGCC 2 cut(s) 254, 640
BtgZI GCGATG 1 cut(s) 526
BtsCI GGATG 2 cut(s) 89, 775
BtsIMutI CAGTG 2 cut(s) 144, 304
Cac8I GCNNGC 1 cut(s) 556
Cfr13I GGNCC 2 cut(s) 455, 639
CviAII CATG 5 cut(s) 7, 69, 226, 713, 760
DdeI CTNAG 5 cut(s) 88, 110, 308, 400, 651
DraI TTTAAA 1 cut(s) 783
DriI GACNNNNNGTC 1 cut(s) 502
Eam1105I GACNNNNNGTC 1 cut(s) 502
Ecl136II GAGCTC 1 cut(s) 732
Eco105I TACGTA 1 cut(s) 351
Eco130I CCWWGG 1 cut(s) 735
Eco24I GRGCYC 1 cut(s) 734
Eco47I GGWCC 1 cut(s) 455
Eco53kI GAGCTC 1 cut(s) 732
Eco81I CCTNAGG 1 cut(s) 651
EcoICRI GAGCTC 1 cut(s) 732
EcoRI GAATTC 1 cut(s) 303
EcoT14I CCWWGG 1 cut(s) 735
EcoT22I ATGCAT 1 cut(s) 761
EcoT38I GRGCYC 1 cut(s) 734
ErhI CCWWGG 1 cut(s) 735
FaeI CATG 5 cut(s) 10, 72, 229, 716, 763
FalI AAGNNNNNCTT 4 cut(s) 11, 43, 542, 574
FatI CATG 5 cut(s) 6, 68, 225, 712, 759
FauNDI CATATG 1 cut(s) 755
FblI GTMKAC 1 cut(s) 369
FokI GGATG 2 cut(s) 96, 782
FriOI GRGCYC 1 cut(s) 734
FspBI CTAG 4 cut(s) 32, 362, 636, 705
GsuI CTGGAG 1 cut(s) 280
HaeIII GGCC 2 cut(s) 254, 640
Hin1II CATG 5 cut(s) 10, 72, 229, 716, 763
HincII GTYRAC 1 cut(s) 96
HindII GTYRAC 1 cut(s) 96
HinfI GANTC 2 cut(s) 92, 398
HphI GGTGA 1 cut(s) 325
Hpy166II GTNNAC 3 cut(s) 96, 370, 718
Hpy188I TCNGA 4 cut(s) 91, 151, 309, 467
Hpy188III TCNNGA 2 cut(s) 362, 507
Hpy8I GTNNAC 3 cut(s) 96, 370, 718
HpyAV CCTTC 3 cut(s) 720, 743, 760
HpyCH4III ACNGT 2 cut(s) 139, 215
HpyCH4IV ACGT 2 cut(s) 321, 350
HpyCH4V TGCA 6 cut(s) 201, 271, 325, 339, 759, 773
HpyF10VI GCNNNNNNNGC 4 cut(s) 162, 260, 551, 605
HpyF3I CTNAG 5 cut(s) 88, 110, 308, 400, 651
HpySE526I ACGT 2 cut(s) 321, 350
Hsp92II CATG 5 cut(s) 10, 72, 229, 716, 763
LmnI GCTCC 3 cut(s) 299, 729, 737
LpnPI CCDG 4 cut(s) 310, 487, 492, 638
LweI GCATC 2 cut(s) 74, 760
MaeI CTAG 4 cut(s) 32, 362, 636, 705
MaeII ACGT 2 cut(s) 321, 350
MaeIII GTNAC 1 cut(s) 313
MboII GAAGA 4 cut(s) 71, 154, 166, 425
MhlI GDGCHC 2 cut(s) 582, 734
MluCI AATT 2 cut(s) 303, 681
MlyI GAGTC 2 cut(s) 101, 392
MnlI CCTC 5 cut(s) 303, 461, 503, 589, 660
Mph1103I ATGCAT 1 cut(s) 761
MseI TTAA 6 cut(s) 45, 168, 204, 246, 680, 782
MslI CAYNNNNRTG 3 cut(s) 103, 330, 758
MwoI GCNNNNNNNGC 4 cut(s) 162, 260, 551, 605
NdeI CATATG 1 cut(s) 755
NlaIII CATG 5 cut(s) 10, 72, 229, 716, 763
NmuCI GTSAC 1 cut(s) 313
NsiI ATGCAT 1 cut(s) 761
NspI RCATGY 3 cut(s) 72, 716, 763
NspV TTCGAA 1 cut(s) 670
PleI GAGTC 2 cut(s) 100, 392
PpsI GAGTC 2 cut(s) 100, 392
Ppu21I YACGTR 2 cut(s) 322, 351
PshBI ATTAAT 1 cut(s) 204
Psp124BI GAGCTC 1 cut(s) 734
PspPI GGNCC 2 cut(s) 455, 639
RseI CAYNNNNRTG 3 cut(s) 103, 330, 758
SacI GAGCTC 1 cut(s) 734
SaqAI TTAA 6 cut(s) 45, 168, 204, 246, 680, 782
Sau96I GGNCC 2 cut(s) 455, 639
SchI GAGTC 2 cut(s) 101, 392
SduI GDGCHC 2 cut(s) 582, 734
SetI ASST 9 cut(s) 80, 158, 265, 324, 353, 424, 664, 677, 734
SfaNI GCATC 2 cut(s) 74, 760
SfuI TTCGAA 1 cut(s) 670
SinI GGWCC 1 cut(s) 455
SmiMI CAYNNNNRTG 3 cut(s) 103, 330, 758
SnaBI TACGTA 1 cut(s) 351
Sse9I AATT 2 cut(s) 303, 681
SspMI CTAG 4 cut(s) 32, 362, 636, 705
SstI GAGCTC 1 cut(s) 734
StyI CCWWGG 1 cut(s) 735
TaaI ACNGT 2 cut(s) 139, 215
TaiI ACGT 2 cut(s) 324, 353
TaqI TCGA 1 cut(s) 670
TasI AATT 2 cut(s) 303, 681
Tru1I TTAA 6 cut(s) 45, 168, 204, 246, 680, 782
Tru9I TTAA 6 cut(s) 45, 168, 204, 246, 680, 782
TscAI CASTG 2 cut(s) 144, 304
TseFI GTSAC 1 cut(s) 313
Tsp45I GTSAC 1 cut(s) 313
TspDTI ATGAA 2 cut(s) 557, 603
TspRI CASTG 2 cut(s) 144, 304
VpaK11BI GGWCC 1 cut(s) 455
VspI ATTAAT 1 cut(s) 204
XapI RAATTY 1 cut(s) 303
XbaI TCTAGA 1 cut(s) 361
XceI RCATGY 3 cut(s) 72, 716, 763
XmiI GTMKAC 1 cut(s) 369
XspI CTAG 4 cut(s) 32, 362, 636, 705
Zsp2I ATGCAT 1 cut(s) 761
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.