Rw3G001730

YGGT family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Forward (+)
1440408 .. 1442810
2403 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G001730.1

Sequence Viewer

Length: 516 bp
ATGACTACAGAACCTATCTTTTATCATATTATCAATCAAATTAAGATTTATCTCTTTTACCTCTCGAATCCGATTCTGAAAAGCAAATTGTGCAACCTGAACAACAAGGACAAGCTGACCAGGATTACAAAGCAACGTTGGTCACTACTCTCGCCCAGATGGTCGATGTTTTCTCATTGTTGGCCTTCTCACACCGCTCCTTCCATGGGTGATTTGGACCCTGCTACAGCAAAGCTGGCCATTGCGTTTCTAGGACCCTTTCTGGCTCTATTTTCGTTTCTCTTCGTTGTAAGAATAGTGATGTCCTGGTACCCAAAGATTCCTGTGGGGAAGTTCCCATATGTTTTGGCTTACGCTCCCACAGAGCCAATTCTCATCCCAACCAGAAAGTTGATCCCACCTTTAGGGGGTGTGGACGTAACCCCTGTGGTCTGGTTTGGATTGATTAGTTTCCTGAATGAGATATTAATAGGTCCACAAGGGCTACTTGTGCTTCTATCTCAACAAGTAAACTGA

Protein Analysis

171

Amino Acids

19.4

Weight (kDa)

9.7

Isoelectric Point (pI)

49.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CCB3_YggT PF02325 87 - 156 6.1e-17 CCB3/YggT
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 309
AccB1I GGYRCC 1 cut(s) 309
AccBSI CCGCTC 1 cut(s) 197
AciI CCGC 1 cut(s) 195
AclI AACGTT 1 cut(s) 136
AclWI GGATC 1 cut(s) 388
AcoI YGGCCR 1 cut(s) 237
AfaI GTAC 1 cut(s) 311
AfiI CCNNNNNNNGG 3 cut(s) 206, 404, 407
AjnI CCWGG 2 cut(s) 119, 305
AluBI AGCT 2 cut(s) 115, 235
AluI AGCT 2 cut(s) 115, 235
AlwI GGATC 1 cut(s) 388
AoxI GGCC 2 cut(s) 182, 237
AseI ATTAAT 1 cut(s) 467
Asp718I GGTACC 1 cut(s) 309
AspS9I GGNCC 3 cut(s) 217, 254, 473
AsuHPI GGTGA 1 cut(s) 221
AvaII GGWCC 3 cut(s) 217, 254, 473
BalI TGGCCA 1 cut(s) 239
BanI GGYRCC 1 cut(s) 309
BccI CCATC 1 cut(s) 153
BciT130I CCWGG 2 cut(s) 121, 307
BfaI CTAG 1 cut(s) 251
BfmI CTRYAG 2 cut(s) 6, 225
Bme1390I CCNGG 2 cut(s) 121, 307
Bme18I GGWCC 3 cut(s) 217, 254, 473
BmgT120I GGNCC 3 cut(s) 217, 254, 473
BmiI GGNNCC 3 cut(s) 219, 256, 311
BmrFI CCNGG 2 cut(s) 121, 307
BsaJI CCNNGG 1 cut(s) 204
Bsc4I CCNNNNNNNGG 3 cut(s) 206, 404, 407
Bse3DI GCAATG 1 cut(s) 240
BseBI CCWGG 2 cut(s) 121, 307
BseDI CCNNGG 1 cut(s) 204
BseGI GGATG 1 cut(s) 375
BseLI CCNNNNNNNGG 3 cut(s) 206, 404, 407
BseMI GCAATG 1 cut(s) 240
BshFI GGCC 2 cut(s) 184, 239
BshNI GGYRCC 1 cut(s) 309
BslI CCNNNNNNNGG 3 cut(s) 206, 404, 407
BsnI GGCC 2 cut(s) 184, 239
Bsp143I GATC 1 cut(s) 393
Bsp19I CCATGG 1 cut(s) 204
BspACI CCGC 1 cut(s) 195
BspANI GGCC 2 cut(s) 184, 239
BspLI GGNNCC 3 cut(s) 219, 256, 311
BspPI GGATC 1 cut(s) 388
BspT107I GGYRCC 1 cut(s) 309
BsrBI CCGCTC 1 cut(s) 197
BsrDI GCAATG 1 cut(s) 240
BssECI CCNNGG 1 cut(s) 204
BssMI GATC 1 cut(s) 393
BssT1I CCWWGG 1 cut(s) 204
Bst2UI CCWGG 2 cut(s) 121, 307
Bst6I CTCTTC 1 cut(s) 287
BstAPI GCANNNNNTGC 1 cut(s) 90
BstC8I GCNNGC 1 cut(s) 237
BstDSI CCRYGG 1 cut(s) 204
BstF5I GGATG 1 cut(s) 375
BstKTI GATC 1 cut(s) 396
BstMBI GATC 1 cut(s) 393
BstMWI GCNNNNNNNGC 3 cut(s) 90, 236, 490
BstNI CCWGG 2 cut(s) 121, 307
BstSCI CCNGG 2 cut(s) 119, 305
BstSFI CTRYAG 2 cut(s) 6, 225
BsuRI GGCC 2 cut(s) 184, 239
BtgI CCRYGG 1 cut(s) 204
BtsCI GGATG 1 cut(s) 375
Cac8I GCNNGC 1 cut(s) 237
Cfr13I GGNCC 3 cut(s) 217, 254, 473
Csp6I GTAC 1 cut(s) 310
CviAII CATG 1 cut(s) 205
CviJI RGCY 8 cut(s) 115, 184, 235, 239, 266, 350, 367, 484
CviKI_1 RGCY 8 cut(s) 115, 184, 235, 239, 266, 350, 367, 484
CviQI GTAC 1 cut(s) 310
DpnI GATC 1 cut(s) 395
DpnII GATC 1 cut(s) 393
EaeI YGGCCR 1 cut(s) 237
Eam1104I CTCTTC 1 cut(s) 287
EarI CTCTTC 1 cut(s) 287
Eco130I CCWWGG 1 cut(s) 204
Eco47I GGWCC 3 cut(s) 217, 254, 473
EcoO109I RGGNCCY 1 cut(s) 254
EcoRII CCWGG 2 cut(s) 119, 305
EcoT14I CCWWGG 1 cut(s) 204
ErhI CCWWGG 1 cut(s) 204
FaeI CATG 1 cut(s) 208
FaiI YATR 4 cut(s) 27, 206, 340, 342
FalI AAGNNNNNCTT 2 cut(s) 471, 503
FatI CATG 1 cut(s) 204
FauNDI CATATG 1 cut(s) 340
FokI GGATG 1 cut(s) 362
FspBI CTAG 1 cut(s) 251
HaeIII GGCC 2 cut(s) 184, 239
Hin1II CATG 1 cut(s) 208
HinfI GANTC 3 cut(s) 67, 73, 319
HphI GGTGA 1 cut(s) 221
Hpy166II GTNNAC 3 cut(s) 415, 476, 511
Hpy188I TCNGA 2 cut(s) 72, 78
Hpy188III TCNNGA 2 cut(s) 64, 454
Hpy8I GTNNAC 3 cut(s) 415, 476, 511
HpyAV CCTTC 2 cut(s) 195, 210
HpyCH4IV ACGT 2 cut(s) 136, 417
HpyCH4V TGCA 1 cut(s) 93
HpyF10VI GCNNNNNNNGC 3 cut(s) 90, 236, 490
HpySE526I ACGT 2 cut(s) 136, 417
Hsp92II CATG 1 cut(s) 208
KpnI GGTACC 1 cut(s) 313
Kzo9I GATC 1 cut(s) 393
LmnI GCTCC 2 cut(s) 202, 361
MaeI CTAG 1 cut(s) 251
MaeII ACGT 2 cut(s) 136, 417
MaeIII GTNAC 2 cut(s) 141, 418
MalI GATC 1 cut(s) 395
MbiI CCGCTC 1 cut(s) 197
MboI GATC 1 cut(s) 393
MboII GAAGA 1 cut(s) 274
MlsI TGGCCA 1 cut(s) 239
MluCI AATT 3 cut(s) 39, 86, 369
MluNI TGGCCA 1 cut(s) 239
MnlI CCTC 1 cut(s) 71
Mox20I TGGCCA 1 cut(s) 239
MscI TGGCCA 1 cut(s) 239
MseI TTAA 2 cut(s) 42, 467
Msp20I TGGCCA 1 cut(s) 239
MspR9I CCNGG 2 cut(s) 121, 307
MvaI CCWGG 2 cut(s) 121, 307
MwoI GCNNNNNNNGC 3 cut(s) 90, 236, 490
NcoI CCATGG 1 cut(s) 204
NdeI CATATG 1 cut(s) 340
NdeII GATC 1 cut(s) 393
NlaIII CATG 1 cut(s) 208
NlaIV GGNNCC 3 cut(s) 219, 256, 311
NmuCI GTSAC 1 cut(s) 141
PfeI GAWTC 3 cut(s) 67, 73, 319
PpuMI RGGWCCY 1 cut(s) 254
PshBI ATTAAT 1 cut(s) 467
Psp1406I AACGTT 1 cut(s) 136
Psp5II RGGWCCY 1 cut(s) 254
Psp6I CCWGG 2 cut(s) 119, 305
PspGI CCWGG 2 cut(s) 119, 305
PspN4I GGNNCC 3 cut(s) 219, 256, 311
PspPI GGNCC 3 cut(s) 217, 254, 473
PspPPI RGGWCCY 1 cut(s) 254
RsaI GTAC 1 cut(s) 311
RsaNI GTAC 1 cut(s) 310
SaqAI TTAA 2 cut(s) 42, 467
Sau3AI GATC 1 cut(s) 393
Sau96I GGNCC 3 cut(s) 217, 254, 473
ScrFI CCNGG 2 cut(s) 121, 307
SetI ASST 9 cut(s) 16, 63, 99, 117, 139, 237, 403, 420, 475
SfcI CTRYAG 2 cut(s) 6, 225
SinI GGWCC 3 cut(s) 217, 254, 473
Sse9I AATT 3 cut(s) 39, 86, 369
SsiI CCGC 1 cut(s) 195
SspMI CTAG 1 cut(s) 251
StyD4I CCNGG 2 cut(s) 119, 305
StyI CCWWGG 1 cut(s) 204
TaiI ACGT 2 cut(s) 139, 420
TaqI TCGA 2 cut(s) 65, 164
TasI AATT 3 cut(s) 39, 86, 369
TfiI GAWTC 3 cut(s) 67, 73, 319
Tru1I TTAA 2 cut(s) 42, 467
Tru9I TTAA 2 cut(s) 42, 467
TseFI GTSAC 1 cut(s) 141
Tsp45I GTSAC 1 cut(s) 141
VpaK11BI GGWCC 3 cut(s) 217, 254, 473
VspI ATTAAT 1 cut(s) 467
XcmI CCANNNNNNNNNTGG 1 cut(s) 211
XspI CTAG 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.