Rw7G037140

Belongs to the DHHC palmitoyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
56460309 .. 56461340
1032 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G037140.1

Sequence Viewer

Length: 228 bp
ATGGCTAACGGTACTAGAGGTTCGTTAGCCTTAACTTCCCCTGCTAAGGTGATTACTAAAGAATCTCTTTTGGTGGCACAGAAGGAGGATTTGTGTAGAGTGATGGACTTGCTATTTCTGAGGGACTTGGTTATATTCCGCCTGACGCCCCAGCCTGATGTCCATGGCTACTACGCACTCCATTGGGCTGATCTCGCCCACTACATAATTCAGCATGGCGGGGACTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.4

Weight (kDa)

6.38

Isoelectric Point (pI)

30.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018536)

Species Orthologous Gene IDs
pyrus_communis pycom10g06550
rosa_chinensis RchiOBHm_Chr1g0314591
rosa_laevigata RLG00000022053 RLG00000032821
rosa_multiflora Rmu_sc0002370.1_g000019
rosa_samantha Rh1AG011500 Rh2AG552600 Rh2DG464900
rosa_wichuraiana Rw0G018450 Rw7G037140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 139, 219
AcyI GRCGYC 1 cut(s) 146
AfaI GTAC 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 61
BccI CCATC 1 cut(s) 97
BfaI CTAG 1 cut(s) 15
Bpu10I CCTNAGC 1 cut(s) 45
BsaHI GRCGYC 1 cut(s) 146
BsaJI CCNNGG 1 cut(s) 163
BsaXI ACNNNNNCTCC 2 cut(s) 77, 107
Bsc4I CCNNNNNNNGG 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 163
BseLI CCNNNNNNNGG 1 cut(s) 46
BseMII CTCAG 1 cut(s) 110
BseYI CCCAGC 1 cut(s) 150
BslFI GGGAC 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 46
BsmFI GGGAC 1 cut(s) 137
Bsp143I GATC 1 cut(s) 190
Bsp19I CCATGG 1 cut(s) 163
BspACI CCGC 2 cut(s) 139, 219
BspCNI CTCAG 1 cut(s) 111
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 1 cut(s) 190
BssNI GRCGYC 1 cut(s) 146
BssT1I CCWWGG 1 cut(s) 163
Bst4CI ACNGT 1 cut(s) 11
BstACI GRCGYC 1 cut(s) 146
BstDEI CTNAG 2 cut(s) 45, 119
BstDSI CCRYGG 1 cut(s) 163
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstMWI GCNNNNNNNGC 1 cut(s) 194
BtgI CCRYGG 1 cut(s) 163
CseI GACGC 1 cut(s) 154
Csp6I GTAC 1 cut(s) 12
CviAII CATG 2 cut(s) 164, 215
CviJI RGCY 5 cut(s) 5, 29, 154, 168, 188
CviKI_1 RGCY 5 cut(s) 5, 29, 154, 168, 188
CviQI GTAC 1 cut(s) 12
DdeI CTNAG 2 cut(s) 45, 119
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
EciI GGCGGA 1 cut(s) 128
Eco130I CCWWGG 1 cut(s) 163
EcoT14I CCWWGG 1 cut(s) 163
ErhI CCWWGG 1 cut(s) 163
FaeI CATG 2 cut(s) 167, 218
FaiI YATR 4 cut(s) 134, 165, 206, 216
FalI AAGNNNNNCTT 2 cut(s) 51, 83
FaqI GGGAC 1 cut(s) 137
FatI CATG 2 cut(s) 163, 214
FauI CCCGC 1 cut(s) 212
FspBI CTAG 1 cut(s) 15
GsaI CCCAGC 1 cut(s) 154
HgaI GACGC 1 cut(s) 154
Hin1I GRCGYC 1 cut(s) 146
Hin1II CATG 2 cut(s) 167, 218
HinfI GANTC 1 cut(s) 62
HphI GGTGA 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 120
HpyAV CCTTC 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 2 cut(s) 45, 119
Hsp92I GRCGYC 1 cut(s) 146
Hsp92II CATG 2 cut(s) 167, 218
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 4 cut(s) 54, 155, 164, 168
MaeI CTAG 1 cut(s) 15
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MluCI AATT 1 cut(s) 207
MnlI CCTC 3 cut(s) 11, 79, 114
MseI TTAA 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 194
NcoI CCATGG 1 cut(s) 163
NdeII GATC 1 cut(s) 190
NlaIII CATG 2 cut(s) 167, 218
PfeI GAWTC 1 cut(s) 62
PspFI CCCAGC 1 cut(s) 150
PsrI GAACNNNNNNTAC 1 cut(s) 36
RsaI GTAC 1 cut(s) 13
RsaNI GTAC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 32
Sau3AI GATC 1 cut(s) 190
SetI ASST 2 cut(s) 22, 51
SgeI CNNG 9 cut(s) 27, 53, 121, 139, 154, 163, 167, 176, 206
Sse9I AATT 1 cut(s) 207
SsiI CCGC 2 cut(s) 139, 219
SspMI CTAG 1 cut(s) 15
StyI CCWWGG 1 cut(s) 163
TaaI ACNGT 1 cut(s) 11
TasI AATT 1 cut(s) 207
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.