AT1G16430

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. The Mediator complex, having a compact conformation in its free form, is recruited to promoters by direct interactions with regulatory proteins and serves for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0012927
Physical Location & Seq
Forward (+)
5614593 .. 5615660
1068 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G16430.1

Sequence Viewer

Length: 453 bp
ATGATGAACAAAGGCGGTGGTTCCGGTGGAGGAAGCGGACCAACAGCTGCTGCGGCAGCCGCTGCGTTACAGAAGCAAAAGGCGTTGTTGCAGAGAGTTGATACTGACATCACATCTGTCGTCGATAACTTCAATCAAATCGTCAATGTCGCAAGGGTGAGTGATCCGCCAATGAAGAACTCTCAGGAAGCATACATGATGGAGATGCGAGCATCAAGATTGGTTCAAGCAGCTGATTCTCTTTTGAAACTTGTATCAGAGCTGAAGCAAACCGCGATTTTTTCAGGATTTGCATCATTAAACGATCATGTAGAACAAAGAATTGCAGAGTTTGATCAAGAGGCCGAGAAGACGAATCGATTGTTGGCTAGAATTGCTGATGATGCATCTGCTAGTCTTAAAGAGCTTGAGTCTCACTATTACTCTTCTGCTCAGAGATCGACTCTAGACTAA

Protein Analysis

150

Amino Acids

16.18

Weight (kDa)

5.4

Isoelectric Point (pI)

34.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med22 PF06179 31 - 130 2.1e-30 Surfeit locus protein 5 subunit 22 of Mediator complex
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012927)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G07950 AT1G07950 AT1G16430
fragaria_vesca FvH4_3g13800
malus_domestica MD02G1009700.v1.1
prunus_persica Prupe.7G260300_v2.0.a1 Prupe.7G260300_v2.0.a1
pyrus_communis pycom15g13880
rosa_chinensis RchiOBHm_Chr5g0022991
rosa_laevigata RLG00000032687
rosa_multiflora Rmu_sc0002675.1_g000006
rosa_roxburghii Rroxscaffold_1G00056350
rosa_rugosa Rorug05G0076300
rosa_samantha Rh5AG162500 Rh5BG161700 Rh5CG176400 Rh5DG163100
rosa_wichuraiana Rw5G014640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 275
AciI CCGC 6 cut(s) 15, 36, 53, 60, 167, 273
AclWI GGATC 1 cut(s) 158
AcuI CTGAAG 1 cut(s) 284
AgsI TTSAA 3 cut(s) 133, 227, 247
AjuI GAANNNNNNNTTGG 2 cut(s) 347, 379
AluBI AGCT 4 cut(s) 47, 233, 262, 406
AluI AGCT 4 cut(s) 47, 233, 262, 406
Alw26I GTCTC 1 cut(s) 417
AlwI GGATC 1 cut(s) 158
AlwNI CAGNNNCTG 2 cut(s) 50, 62
AoxI GGCC 1 cut(s) 342
ApeKI GCWGC 5 cut(s) 47, 50, 56, 62, 230
AspS9I GGNCC 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 169
AvaII GGWCC 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 356
BbvI GCAGC 5 cut(s) 34, 37, 49, 68, 242
BccI CCATC 1 cut(s) 193
BclI TGATCA 1 cut(s) 334
BcoDI GTCTC 1 cut(s) 417
BfaI CTAG 3 cut(s) 369, 393, 446
BisI GCNGC 7 cut(s) 48, 51, 54, 57, 60, 63, 231
BlsI GCNGC 7 cut(s) 49, 52, 55, 58, 61, 64, 232
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
BmiI GGNNCC 1 cut(s) 22
BmsI GCATC 5 cut(s) 195, 221, 302, 373, 395
BpiI GAAGAC 1 cut(s) 356
BplI GAGNNNNNCTC 1 cut(s) 427
BpuEI CTTGAG 1 cut(s) 428
Bsa29I ATCGAT 1 cut(s) 358
BsaBI GATNNNNATC 1 cut(s) 292
BsaWI WCCGGW 1 cut(s) 23
Bse8I GATNNNNATC 1 cut(s) 292
BseCI ATCGAT 1 cut(s) 358
BseJI GATNNNNATC 1 cut(s) 292
BseMII CTCAG 2 cut(s) 197, 446
BseXI GCAGC 5 cut(s) 34, 37, 49, 68, 242
Bsh1236I CGCG 1 cut(s) 275
BshFI GGCC 1 cut(s) 344
BshVI ATCGAT 1 cut(s) 358
BsiSI CCGG 1 cut(s) 24
BsmAI GTCTC 1 cut(s) 417
BsnI GGCC 1 cut(s) 344
Bsp143I GATC 4 cut(s) 163, 304, 334, 437
BspACI CCGC 6 cut(s) 15, 36, 53, 60, 167, 273
BspANI GGCC 1 cut(s) 344
BspCNI CTCAG 2 cut(s) 196, 445
BspDI ATCGAT 1 cut(s) 358
BspFNI CGCG 1 cut(s) 275
BspLI GGNNCC 1 cut(s) 22
BspPI GGATC 1 cut(s) 158
BssMI GATC 4 cut(s) 163, 304, 334, 437
Bst6I CTCTTC 1 cut(s) 430
BstAPI GCANNNNNTGC 1 cut(s) 62
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 2 cut(s) 183, 432
BstFNI CGCG 1 cut(s) 275
BstKTI GATC 4 cut(s) 166, 307, 337, 440
BstMAI GTCTC 1 cut(s) 417
BstMBI GATC 4 cut(s) 163, 304, 334, 437
BstMWI GCNNNNNNNGC 6 cut(s) 53, 56, 59, 62, 374, 383
BstUI CGCG 1 cut(s) 275
BstV1I GCAGC 5 cut(s) 34, 37, 49, 68, 242
BstV2I GAAGAC 1 cut(s) 356
Bsu15I ATCGAT 1 cut(s) 358
BsuRI GGCC 1 cut(s) 344
BsuTUI ATCGAT 1 cut(s) 358
Cac8I GCNNGC 1 cut(s) 210
CaiI CAGNNNCTG 2 cut(s) 50, 62
Cfr13I GGNCC 1 cut(s) 38
ClaI ATCGAT 1 cut(s) 358
CspCI CAANNNNNGTGG 1 cut(s) 33
CviAII CATG 2 cut(s) 196, 308
CviJI RGCY 7 cut(s) 47, 59, 233, 262, 344, 368, 406
CviKI_1 RGCY 7 cut(s) 47, 59, 233, 262, 344, 368, 406
DdeI CTNAG 2 cut(s) 183, 432
DpnI GATC 4 cut(s) 165, 306, 336, 439
DpnII GATC 4 cut(s) 163, 304, 334, 437
Eam1104I CTCTTC 1 cut(s) 430
EarI CTCTTC 1 cut(s) 430
EciI GGCGGA 1 cut(s) 156
Eco47I GGWCC 1 cut(s) 38
Eco57I CTGAAG 1 cut(s) 284
EcoT22I ATGCAT 1 cut(s) 388
FaeI CATG 2 cut(s) 199, 311
FaiI YATR 3 cut(s) 193, 197, 309
FatI CATG 2 cut(s) 195, 307
FbaI TGATCA 1 cut(s) 334
Fnu4HI GCNGC 7 cut(s) 48, 51, 54, 57, 60, 63, 231
Fsp4HI GCNGC 7 cut(s) 48, 51, 54, 57, 60, 63, 231
FspBI CTAG 3 cut(s) 369, 393, 446
GluI GCNGC 7 cut(s) 48, 51, 54, 57, 60, 63, 231
HaeIII GGCC 1 cut(s) 344
HapII CCGG 1 cut(s) 24
Hin1II CATG 2 cut(s) 199, 311
HinfI GANTC 4 cut(s) 236, 355, 410, 442
HpaII CCGG 1 cut(s) 24
HphI GGTGA 1 cut(s) 169
Hpy188I TCNGA 2 cut(s) 259, 435
Hpy188III TCNNGA 5 cut(s) 185, 216, 285, 338, 446
Hpy99I CGWCG 1 cut(s) 125
HpyCH4V TGCA 4 cut(s) 91, 293, 326, 386
HpyF10VI GCNNNNNNNGC 6 cut(s) 53, 56, 59, 62, 374, 383
HpyF3I CTNAG 2 cut(s) 183, 432
Hsp92II CATG 2 cut(s) 199, 311
Ksp22I TGATCA 1 cut(s) 334
Kzo9I GATC 4 cut(s) 163, 304, 334, 437
LpnPI CCDG 3 cut(s) 37, 170, 270
Lsp1109I GCAGC 5 cut(s) 34, 37, 49, 68, 242
LweI GCATC 5 cut(s) 195, 221, 302, 373, 395
MaeI CTAG 3 cut(s) 369, 393, 446
MaeIII GTNAC 1 cut(s) 66
MalI GATC 4 cut(s) 165, 306, 336, 439
MboI GATC 4 cut(s) 163, 304, 334, 437
MboII GAAGA 3 cut(s) 187, 361, 417
MluCI AATT 2 cut(s) 321, 372
MlyI GAGTC 2 cut(s) 419, 436
MnlI CCTC 2 cut(s) 23, 334
Mph1103I ATGCAT 1 cut(s) 388
MseI TTAA 2 cut(s) 299, 399
MspA1I CMGCKG 3 cut(s) 47, 62, 233
MspI CCGG 1 cut(s) 24
MvnI CGCG 1 cut(s) 275
MwoI GCNNNNNNNGC 6 cut(s) 53, 56, 59, 62, 374, 383
NdeII GATC 4 cut(s) 163, 304, 334, 437
NlaIII CATG 2 cut(s) 199, 311
NlaIV GGNNCC 1 cut(s) 22
NmeAIII GCCGAG 1 cut(s) 370
NsiI ATGCAT 1 cut(s) 388
PfeI GAWTC 2 cut(s) 236, 355
PkrI GCNGC 7 cut(s) 49, 52, 55, 58, 61, 64, 232
PleI GAGTC 2 cut(s) 418, 436
PpsI GAGTC 2 cut(s) 418, 436
PspN4I GGNNCC 1 cut(s) 22
PspPI GGNCC 1 cut(s) 38
PstNI CAGNNNCTG 2 cut(s) 50, 62
PvuII CAGCTG 2 cut(s) 47, 233
SaqAI TTAA 2 cut(s) 299, 399
SatI GCNGC 7 cut(s) 48, 51, 54, 57, 60, 63, 231
Sau3AI GATC 4 cut(s) 163, 304, 334, 437
Sau96I GGNCC 1 cut(s) 38
SchI GAGTC 2 cut(s) 419, 436
SetI ASST 4 cut(s) 49, 235, 264, 408
SfaNI GCATC 5 cut(s) 195, 221, 302, 373, 395
SinI GGWCC 1 cut(s) 38
SmlI CTYRAG 1 cut(s) 407
SmoI CTYRAG 1 cut(s) 407
Sse9I AATT 2 cut(s) 321, 372
SsiI CCGC 6 cut(s) 15, 36, 53, 60, 167, 273
SspMI CTAG 3 cut(s) 369, 393, 446
TaqI TCGA 3 cut(s) 123, 358, 440
TasI AATT 2 cut(s) 321, 372
TauI GCSGC 2 cut(s) 56, 62
TfiI GAWTC 2 cut(s) 236, 355
Tru1I TTAA 2 cut(s) 299, 399
Tru9I TTAA 2 cut(s) 299, 399
TseI GCWGC 5 cut(s) 47, 50, 56, 62, 230
TspDTI ATGAA 2 cut(s) 20, 188
VpaK11BI GGWCC 1 cut(s) 38
XbaI TCTAGA 1 cut(s) 445
XspI CTAG 3 cut(s) 369, 393, 446
Zsp2I ATGCAT 1 cut(s) 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.