AT1G53903

zinc-finger of the FCS-type, C2-C2

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
20132071 .. 20133045
975 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G53903.1

Sequence Viewer

Length: 381 bp
ATGACTAAAATCTCTGTTGGATTGCAACTTGTGACAAGAGATTCGAGGGAAAAACTAAACAATATAGTGATCAAATCTTCACTGAGACTAAACCGATCCAATCCAAACATCTCGGAGCTTTGTTTCCTTAAAACATGTCATCTCTGCAATAAACAACTCCATCAAGACAAAGATGTTTACATGTACAGAGGAGATTTGGGATTTTGTAGTAGAGAGTGCAGAGAAAGTCAGATGTTGATTGATGATAGAAAAGAACTAGAGGCTTCGACGAAGATGATGTTGGCTTCGTACAGACGATGTAATAACGGCGCCGGAAAAAGCGAGTCTCGGAATTTGTTTGATGATCTCCGGCGACGACGTCAATTATTTATAGTTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.76

Weight (kDa)

9.57

Isoelectric Point (pI)

69.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-FLZ PF04570 38 - 84 1.4e-21 zinc-finger of the FCS-type, C2-C2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012920)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53885 AT1G53903
fragaria_vesca FvH4_6g35720
malus_domestica MD09G1173600.v1.1 MD17G1153400.v1.1
prunus_persica Prupe.3G031700_v2.0.a1
pyrus_communis pycom09g09100 pycom17g14630
rosa_chinensis RchiOBHm_Chr2g0147731
rosa_laevigata RLG00000020273
rosa_multiflora Rmu_sc0000308.1_g000023
rosa_roxburghii Rroxscaffold_2G00099370
rosa_rugosa Rorug02G0401400
rosa_samantha Rh2AG458500 Rh2BG471600 Rh2CG445800 Rh2DG480500
rosa_wichuraiana Rw2G037480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 361
AccB1I GGYRCC 1 cut(s) 308
AclWI GGATC 1 cut(s) 90
AcsI RAATTY 1 cut(s) 331
AcyI GRCGYC 2 cut(s) 309, 358
AfaI GTAC 2 cut(s) 185, 290
AflIII ACRYGT 2 cut(s) 134, 180
AjuI GAANNNNNNNTTGG 2 cut(s) 263, 295
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
Alw26I GTCTC 2 cut(s) 79, 330
AlwI GGATC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 331
ArsI GACNNNNNNTTYG 2 cut(s) 25, 57
AspLEI GCGC 1 cut(s) 311
BanI GGYRCC 1 cut(s) 308
BccI CCATC 1 cut(s) 168
BceAI ACGGC 1 cut(s) 322
BclI TGATCA 1 cut(s) 69
BcoDI GTCTC 2 cut(s) 79, 330
BfaI CTAG 1 cut(s) 257
BfoI RGCGCY 1 cut(s) 312
BmiI GGNNCC 1 cut(s) 310
BsaHI GRCGYC 2 cut(s) 309, 358
BseMII CTCAG 1 cut(s) 74
BseRI GAGGAG 1 cut(s) 204
BsgI GTGCAG 1 cut(s) 238
BshNI GGYRCC 1 cut(s) 308
BsiSI CCGG 2 cut(s) 312, 349
BsmAI GTCTC 2 cut(s) 79, 330
Bsp1407I TGTACA 1 cut(s) 183
Bsp143I GATC 3 cut(s) 69, 95, 343
BspCNI CTCAG 1 cut(s) 75
BspLI GGNNCC 1 cut(s) 310
BspPI GGATC 1 cut(s) 90
BspT107I GGYRCC 1 cut(s) 308
BsrGI TGTACA 1 cut(s) 183
BssMI GATC 3 cut(s) 69, 95, 343
BssNI GRCGYC 2 cut(s) 309, 358
BstACI GRCGYC 2 cut(s) 309, 358
BstAUI TGTACA 1 cut(s) 183
BstDEI CTNAG 1 cut(s) 83
BstH2I RGCGCY 1 cut(s) 312
BstHHI GCGC 1 cut(s) 311
BstKTI GATC 3 cut(s) 72, 98, 346
BstMAI GTCTC 2 cut(s) 79, 330
BstMBI GATC 3 cut(s) 69, 95, 343
BstNSI RCATGY 2 cut(s) 138, 184
BtsIMutI CAGTG 1 cut(s) 80
CfoI GCGC 1 cut(s) 311
Csp6I GTAC 2 cut(s) 184, 289
CviAII CATG 2 cut(s) 135, 181
CviJI RGCY 3 cut(s) 118, 263, 284
CviKI_1 RGCY 3 cut(s) 118, 263, 284
CviQI GTAC 2 cut(s) 184, 289
DdeI CTNAG 1 cut(s) 83
DinI GGCGCC 1 cut(s) 310
DpnI GATC 3 cut(s) 71, 97, 345
DpnII GATC 3 cut(s) 69, 95, 343
EgeI GGCGCC 1 cut(s) 310
EheI GGCGCC 1 cut(s) 310
FaeI CATG 2 cut(s) 138, 184
FaiI YATR 4 cut(s) 65, 136, 182, 371
FatI CATG 2 cut(s) 134, 180
FbaI TGATCA 1 cut(s) 69
FspBI CTAG 1 cut(s) 257
GlaI GCGC 1 cut(s) 310
HaeII RGCGCY 1 cut(s) 312
HapII CCGG 2 cut(s) 312, 349
HhaI GCGC 1 cut(s) 311
Hin1I GRCGYC 2 cut(s) 309, 358
Hin1II CATG 2 cut(s) 138, 184
Hin6I GCGC 1 cut(s) 309
HinP1I GCGC 1 cut(s) 309
HinfI GANTC 2 cut(s) 41, 323
HpaII CCGG 2 cut(s) 312, 349
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 3 cut(s) 115, 231, 330
Hpy188III TCNNGA 1 cut(s) 164
Hpy8I GTNNAC 1 cut(s) 178
Hpy99I CGWCG 3 cut(s) 271, 357, 360
HpyCH4IV ACGT 1 cut(s) 358
HpyCH4V TGCA 3 cut(s) 25, 147, 219
HpyF3I CTNAG 1 cut(s) 83
HpySE526I ACGT 1 cut(s) 358
Hsp92I GRCGYC 2 cut(s) 309, 358
Hsp92II CATG 2 cut(s) 138, 184
HspAI GCGC 1 cut(s) 309
KasI GGCGCC 1 cut(s) 308
Ksp22I TGATCA 1 cut(s) 69
Kzo9I GATC 3 cut(s) 69, 95, 343
LmnI GCTCC 1 cut(s) 115
LpnPI CCDG 2 cut(s) 325, 362
MaeI CTAG 1 cut(s) 257
MaeII ACGT 1 cut(s) 358
MaeIII GTNAC 1 cut(s) 31
MalI GATC 3 cut(s) 71, 97, 345
MboI GATC 3 cut(s) 69, 95, 343
MboII GAAGA 2 cut(s) 69, 283
MluCI AATT 2 cut(s) 331, 362
Mly113I GGCGCC 1 cut(s) 309
MlyI GAGTC 1 cut(s) 332
MnlI CCTC 3 cut(s) 39, 182, 253
MseI TTAA 1 cut(s) 129
MspI CCGG 2 cut(s) 312, 349
NarI GGCGCC 1 cut(s) 309
NdeII GATC 3 cut(s) 69, 95, 343
NlaIII CATG 2 cut(s) 138, 184
NlaIV GGNNCC 1 cut(s) 310
NmuCI GTSAC 1 cut(s) 31
NspI RCATGY 2 cut(s) 138, 184
PciI ACATGT 2 cut(s) 134, 180
PfeI GAWTC 1 cut(s) 41
PflFI GACNNNGTC 1 cut(s) 357
PleI GAGTC 1 cut(s) 331
PluTI GGCGCC 1 cut(s) 312
PpsI GAGTC 1 cut(s) 331
PscI ACATGT 2 cut(s) 134, 180
PspN4I GGNNCC 1 cut(s) 310
PsyI GACNNNGTC 1 cut(s) 357
RsaI GTAC 2 cut(s) 185, 290
RsaNI GTAC 2 cut(s) 184, 289
SaqAI TTAA 1 cut(s) 129
Sau3AI GATC 3 cut(s) 69, 95, 343
SchI GAGTC 1 cut(s) 332
SetI ASST 2 cut(s) 120, 361
SfoI GGCGCC 1 cut(s) 310
Sse9I AATT 2 cut(s) 331, 362
SspDI GGCGCC 1 cut(s) 308
SspMI CTAG 1 cut(s) 257
TaiI ACGT 1 cut(s) 361
TaqI TCGA 2 cut(s) 44, 266
TasI AATT 2 cut(s) 331, 362
TatI WGTACW 1 cut(s) 183
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TscAI CASTG 1 cut(s) 87
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspRI CASTG 1 cut(s) 87
Tth111I GACNNNGTC 1 cut(s) 357
XapI RAATTY 1 cut(s) 331
XceI RCATGY 2 cut(s) 138, 184
XspI CTAG 1 cut(s) 257
ZraI GACGTC 1 cut(s) 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.