AT1G66045

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
24588269 .. 24588794
526 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G66045.1

Sequence Viewer

Length: 435 bp
ATGCTCGTAATGATTATAATGATCAATCAGTCACCAAAGCAGAGAATAAAGAAGGAACCAGTTAATACAACCTCATTGGAAGTTCCTAGCTCCAACTCTACTTTGTATTGTTATGTAGATGCCTCATGGATTGACGAAAACAGCAAAGCGGGTATTAGTTGGATTCTAACTGAAGTGCATGGCCGATGTCTTCTCAAGAGTTCTTCCTCCATAGAGCATATCGACTCAGTTATTGAAACAGAAGATAAAGCTTCAGTTGAAGCTGTAGGTCACTCATCTCTTGGTCAAGCAGAGATTCAAAGCTACTTAGAAGACATCAAGGCATTAGCTCCAAGCTATTTTCGTTTCAAATTCATTCGTCGGAATGCAAACCATTTAGCTGATGCCCTATCGAAGGAAGCTAGATTAAAAGAATCTCTTTATACTGCATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

144

Amino Acids

16.09

Weight (kDa)

6.08

Isoelectric Point (pI)

51.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018271)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 17
AciI CCGC 1 cut(s) 149
AcoI YGGCCR 1 cut(s) 181
AcsI RAATTY 1 cut(s) 350
AcuI CTGAAG 2 cut(s) 192, 237
AfiI CCNNNNNNNGG 1 cut(s) 394
AgsI TTSAA 4 cut(s) 236, 260, 299, 349
AluBI AGCT 8 cut(s) 90, 251, 263, 303, 329, 336, 380, 401
AluI AGCT 8 cut(s) 90, 251, 263, 303, 329, 336, 380, 401
AoxI GGCC 1 cut(s) 181
ApoI RAATTY 1 cut(s) 350
AsuHPI GGTGA 1 cut(s) 24
BbsI GAAGAC 2 cut(s) 182, 318
BclI TGATCA 1 cut(s) 21
BfaI CTAG 2 cut(s) 87, 402
BfmI CTRYAG 1 cut(s) 264
BmiI GGNNCC 1 cut(s) 57
BmsI GCATC 2 cut(s) 109, 373
BpiI GAAGAC 2 cut(s) 182, 318
BpuEI CTTGAG 1 cut(s) 179
Bsc4I CCNNNNNNNGG 1 cut(s) 394
Bse1I ACTGG 1 cut(s) 59
BseLI CCNNNNNNNGG 1 cut(s) 394
BseMII CTCAG 1 cut(s) 240
BseNI ACTGG 1 cut(s) 59
BshFI GGCC 1 cut(s) 183
BslI CCNNNNNNNGG 1 cut(s) 394
BsmI GAATGC 1 cut(s) 370
BsnI GGCC 1 cut(s) 183
Bsp143I GATC 1 cut(s) 21
BspACI CCGC 1 cut(s) 149
BspANI GGCC 1 cut(s) 183
BspCNI CTCAG 1 cut(s) 239
BspLI GGNNCC 1 cut(s) 57
BsrI ACTGG 1 cut(s) 59
BssMI GATC 1 cut(s) 21
BstDEI CTNAG 2 cut(s) 226, 307
BstENI CCTNNNNNAGG 1 cut(s) 392
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstSFI CTRYAG 1 cut(s) 264
BstV2I GAAGAC 2 cut(s) 182, 318
BsuRI GGCC 1 cut(s) 183
CviAII CATG 2 cut(s) 126, 179
CviJI RGCY 9 cut(s) 90, 183, 251, 263, 303, 329, 336, 380, 401
CviKI_1 RGCY 9 cut(s) 90, 183, 251, 263, 303, 329, 336, 380, 401
DdeI CTNAG 2 cut(s) 226, 307
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
EaeI YGGCCR 1 cut(s) 181
Eco57I CTGAAG 2 cut(s) 192, 237
EcoNI CCTNNNNNAGG 1 cut(s) 392
FaeI CATG 2 cut(s) 129, 182
FaiI YATR 7 cut(s) 17, 114, 127, 180, 212, 219, 423
FalI AAGNNNNNCTT 2 cut(s) 402, 434
FatI CATG 2 cut(s) 125, 178
FauI CCCGC 1 cut(s) 142
FbaI TGATCA 1 cut(s) 21
FspBI CTAG 2 cut(s) 87, 402
HaeIII GGCC 1 cut(s) 183
Hin1II CATG 2 cut(s) 129, 182
HindIII AAGCTT 1 cut(s) 249
HinfI GANTC 4 cut(s) 163, 224, 295, 413
HphI GGTGA 1 cut(s) 24
Hpy188I TCNGA 1 cut(s) 363
Hpy188III TCNNGA 2 cut(s) 196, 432
Hpy99I CGWCG 1 cut(s) 363
HpyAV CCTTC 2 cut(s) 46, 388
HpyCH4V TGCA 3 cut(s) 178, 368, 428
HpyF3I CTNAG 2 cut(s) 226, 307
Hsp92II CATG 2 cut(s) 129, 182
Ksp22I TGATCA 1 cut(s) 21
Kzo9I GATC 1 cut(s) 21
LmnI GCTCC 2 cut(s) 95, 334
LpnPI CCDG 1 cut(s) 72
LweI GCATC 2 cut(s) 109, 373
MaeI CTAG 2 cut(s) 87, 402
MaeIII GTNAC 2 cut(s) 30, 269
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 4 cut(s) 182, 195, 254, 323
MluCI AATT 1 cut(s) 350
MlyI GAGTC 1 cut(s) 218
MmeI TCCRAC 3 cut(s) 117, 140, 341
MnlI CCTC 3 cut(s) 82, 133, 217
MseI TTAA 2 cut(s) 63, 407
Mva1269I GAATGC 1 cut(s) 370
NdeII GATC 1 cut(s) 21
NlaIII CATG 2 cut(s) 129, 182
NlaIV GGNNCC 1 cut(s) 57
NmuCI GTSAC 2 cut(s) 30, 269
PctI GAATGC 1 cut(s) 370
PfeI GAWTC 3 cut(s) 163, 295, 413
PleI GAGTC 1 cut(s) 218
PpsI GAGTC 1 cut(s) 218
PsiI TTATAA 1 cut(s) 17
PspN4I GGNNCC 1 cut(s) 57
SaqAI TTAA 2 cut(s) 63, 407
Sau3AI GATC 1 cut(s) 21
SchI GAGTC 1 cut(s) 218
SfaNI GCATC 2 cut(s) 109, 373
SfcI CTRYAG 1 cut(s) 264
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 1 cut(s) 350
SsiI CCGC 1 cut(s) 149
SspMI CTAG 2 cut(s) 87, 402
TaqI TCGA 2 cut(s) 222, 392
TasI AATT 1 cut(s) 350
TfiI GAWTC 3 cut(s) 163, 295, 413
Tru1I TTAA 2 cut(s) 63, 407
Tru9I TTAA 2 cut(s) 63, 407
TseFI GTSAC 2 cut(s) 30, 269
Tsp45I GTSAC 2 cut(s) 30, 269
TspDTI ATGAA 1 cut(s) 343
XagI CCTNNNNNAGG 1 cut(s) 392
XapI RAATTY 1 cut(s) 350
XspI CTAG 2 cut(s) 87, 402
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.