MD07G1073700.v1.1

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
7002199 .. 7010884
8686 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1073700.v1.1.491

Sequence Viewer

Length: 156 bp
ATGGCAAATTCGAGGGGATTTAAGCGCATCATTGTTGAAGGCGATTCTAAGCTGGTTATCAAGGTTGTTCGCGGTGCCTATCATGTTCCTAGAGACTTAGGACCATTCTTGCTGATTTTTGACGGTTGCATGTTTTCAGAGAAGTCAATTTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.7

Weight (kDa)

9.51

Isoelectric Point (pI)

32.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018271)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 74
AccII CGCG 1 cut(s) 72
AciI CCGC 1 cut(s) 72
AcsI RAATTY 1 cut(s) 7
AgsI TTSAA 1 cut(s) 38
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
Alw26I GTCTC 1 cut(s) 87
ApoI RAATTY 1 cut(s) 7
AspLEI GCGC 1 cut(s) 27
AspS9I GGNCC 1 cut(s) 101
AvaII GGWCC 1 cut(s) 101
BanI GGYRCC 1 cut(s) 74
BcoDI GTCTC 1 cut(s) 87
BfaI CTAG 2 cut(s) 90, 154
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BmiI GGNNCC 1 cut(s) 76
BmsI GCATC 1 cut(s) 36
Bsh1236I CGCG 1 cut(s) 72
BshNI GGYRCC 1 cut(s) 74
BsmAI GTCTC 1 cut(s) 87
BspACI CCGC 1 cut(s) 72
BspFNI CGCG 1 cut(s) 72
BspLI GGNNCC 1 cut(s) 76
BspT107I GGYRCC 1 cut(s) 74
Bst4CI ACNGT 1 cut(s) 125
BstDEI CTNAG 2 cut(s) 48, 97
BstFNI CGCG 1 cut(s) 72
BstHHI GCGC 1 cut(s) 27
BstMAI GTCTC 1 cut(s) 87
BstNSI RCATGY 1 cut(s) 133
BstUI CGCG 1 cut(s) 72
CfoI GCGC 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 101
CviAII CATG 2 cut(s) 83, 130
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
DdeI CTNAG 2 cut(s) 48, 97
Eco47I GGWCC 1 cut(s) 101
FaeI CATG 2 cut(s) 86, 133
FaiI YATR 2 cut(s) 84, 131
FatI CATG 2 cut(s) 82, 129
FspBI CTAG 2 cut(s) 90, 154
FspEI CC 9 cut(s) 24, 38, 47, 57, 84, 91, 102, 108, 117
GlaI GCGC 1 cut(s) 26
HhaI GCGC 1 cut(s) 27
Hin1II CATG 2 cut(s) 86, 133
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HinfI GANTC 1 cut(s) 44
Hpy188I TCNGA 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 32
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 2 cut(s) 48, 97
Hsp92II CATG 2 cut(s) 86, 133
HspAI GCGC 1 cut(s) 25
LpnPI CCDG 1 cut(s) 38
LweI GCATC 1 cut(s) 36
MaeI CTAG 2 cut(s) 90, 154
MluCI AATT 2 cut(s) 7, 147
MnlI CCTC 1 cut(s) 6
MseI TTAA 1 cut(s) 21
MvnI CGCG 1 cut(s) 72
NlaIII CATG 2 cut(s) 86, 133
NlaIV GGNNCC 1 cut(s) 76
NspI RCATGY 1 cut(s) 133
PfeI GAWTC 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 76
PspPI GGNCC 1 cut(s) 101
SaqAI TTAA 1 cut(s) 21
Sau96I GGNCC 1 cut(s) 101
SetI ASST 2 cut(s) 54, 66
SfaNI GCATC 1 cut(s) 36
SgeI CNNG 8 cut(s) 24, 65, 73, 83, 95, 102, 121, 142
SinI GGWCC 1 cut(s) 101
Sse9I AATT 2 cut(s) 7, 147
SsiI CCGC 1 cut(s) 72
SspMI CTAG 2 cut(s) 90, 154
TaaI ACNGT 1 cut(s) 125
TaqI TCGA 1 cut(s) 11
TasI AATT 2 cut(s) 7, 147
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
VpaK11BI GGWCC 1 cut(s) 101
XapI RAATTY 1 cut(s) 7
XceI RCATGY 1 cut(s) 133
XspI CTAG 2 cut(s) 90, 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.